LXL04_012643 | RubberDandelionOmics

Gene overview

LXL04_012643

Reference: OH-1004 Chr: Chr03 Coordinates: 16206868-16208215 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1068 bp · LXL04_012643|LXL04_012643|OH1004|cDNA

ATGGAGATTAAAGAAGCCGAAAGGACAATCATAGCAAAACCAATTGCTTCAAGACCTACCATTTCCAATTTCGCCGACTTCCTTCCCAGTTCTTCAAACATTTTACTTTTACCCTCATCAGAACCCACAGTCACTGTCATCAGACCCAAAACAGTGAGATTCAAACCTATCATTAACTCTCCAAATGTTGACATAATTTCTTCTCAAATCCTAAAATCAGACCACACATCTCCGTTGTTATATAAACCGTTAGCAAAGAC...

CDS

Download CDS FASTA

1068 bp · LXL04_012643|LXL04_012643|OH1004|CDS

ATGGAGATTAAAGAAGCCGAAAGGACAATCATAGCAAAACCAATTGCTTCAAGACCTACCATTTCCAATTTCGCCGACTTCCTTCCCAGTTCTTCAAACATTTTACTTTTACCCTCATCAGAACCCACAGTCACTGTCATCAGACCCAAAACAGTGAGATTCAAACCTATCATTAACTCTCCAAATGTTGACATAATTTCTTCTCAAATCCTAAAATCAGACCACACATCTCCGTTGTTATATAAACCGTTAGCAAAGAC...

Protein

Download Protein FASTA

355 aa · LXL04_012643|LXL04_012643|OH1004|PROTEIN

MEIKEAERTIIAKPIASRPTISNFADFLPSSSNILLLPSSEPTVTVIRPKTVRFKPIINSPNVDIISSQILKSDHTSPLLYKPLAKTVSRTTISLLANMGTSNTNHEQPLTHNLESQNPPILTPVVKSNDKTLNLQTNISDRPSYDGYNWRKYGQKQVKGSEYPRSYYKCTHPNCMVKKKVERCINGEIAEIVYKGEHSHSKPRLPRRHAFDGTAKEPEVVGSSSRLTNLVKVNEACEGSRSTVDCRCGGGVDEPMSKKR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012643`
TK1151 ID	TkA02G547530
OH-1004 ID	LXL04_012643
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012643

Location Chr03:16206868-16208215 (-)

Description Similar to WRKY44: WRKY transcription factor 44

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37260`	Transcription factor.	TRANSPARENT TESTA GLABRA2, a trichome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor.2002 · DOI: 10.1105/tpc.001404
`At2g03340`	Transcription factor.	No verified direct reference in this release
`At1g13960`	Transcription factor that binds specifically to the W box (5'-(T)TGAC[CT]-3'), a frequently occurring elicitor-responsive cis- acting element.	Roles of Arabidopsis WRKY3 and WRKY4 transcription factors in plant responses to pathogens.2008 · DOI: 10.1186/1471-2229-8-68 Structural basis for sequence-specific DNA recognition by an Arabidopsis WRKY transcription factor.2012 · DOI: 10.1074/jbc.m111.279844

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0826400`	May participate in transcriptional regulation of abscisic acid and gibberellin signaling.	Annotations and functional analyses of the rice WRKY gene superfamily reveal positive and negative regulators of abscisic acid signaling in aleurone cells.2005 · DOI: 10.1104/pp.104.054312 A negative regulator encoded by a rice WRKY gene represses both abscisic acid and gibberellins signaling in aleurone cells.2009 · DOI: 10.1007/s11103-009-9463-4

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012643 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0010214 seed coat development Biological Process

GO:0090628 plant epidermal cell fate specification Biological Process

GO:1900150 regulation of defense response to fungus Biological Process

GO:1900425 negative regulation of defense response to bacterium Biological Process

KEGG gene cross-reference

ath:AT1G13960

ath:AT2G03340

ath:AT2G37260

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.956

Rank 1 · LXL04_012643 · OH-1004

Cytoplasm0.121

Rank 2 · LXL04_012643 · OH-1004

Cell membrane0.019

Rank 3 · LXL04_012643 · OH-1004

Mitochondrion0.014

Rank 4 · LXL04_012643 · OH-1004

Endoplasmic reticulum0.009

Rank 5 · LXL04_012643 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03106.22WRKY146-200 aa

PF03106.22WRKY292-348 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012643	`PF03106.22`	WRKY	146	200	1.9e-52	176.0
LXL04_012643	`PF03106.22`	WRKY	292	348	1.9e-52	176.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZUU0`	Arabidopsis thaliana	WRKY transcription factor 44	40.187%	Swiss-Prot	moderate database homology
`Q9ZQ70`	Arabidopsis thaliana	Probable WRKY transcription factor 3	46.250%	Swiss-Prot	moderate database homology
`Q9XI90`	Arabidopsis thaliana	Probable WRKY transcription factor 4	44.898%	Swiss-Prot	moderate database homology
`Q6IEQ7`	Oryza sativa subsp. japonica	WRKY transcription factor WRKY24	51.948%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card