LXL04_012449 | RubberDandelionOmics

Gene overview

LXL04_012449

Reference: OH-1004 Chr: Chr03 Coordinates: 12378625-12380189 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

960 bp · LXL04_012449|LXL04_012449|OH1004|cDNA

aTGAAACTAAAAATACAAGGACTCCCAACCAAACAACACTCATGTGGACTCAATATCCACATATGTTATATCCCTTCATCACGTCAAATAAAGCCATGGAAGCGTCTTCTTCCGAACAGCACACCAATGGCGGTTTCAATTTCATCACTCCCGTTCTCATCGCCAACCTTATCCACAAGGttGAATCTGCCATTGAAACCTTCTTGTTCTACATGCTGTTTGCCAACCATCATTGCGTCCTCAAAAGATGATCAACAAAG...

CDS

Download CDS FASTA

816 bp · LXL04_012449|LXL04_012449|OH1004|CDS

ATGAAACTAAAAATACAAGGACTCCCAACCAAACAACACTCATGTGGACTCAATATCCACATATGTTATATCCCTTCATCACGTCAAATAAAGCCATGGAAGCGTCTTCTTCCGAACAGCACACCAATGGCGGTTTCAATTTCATCACTCCCGTTCTCATCGCCAACCTTATCCACAAGGTTGAATCTGCCATTGAAACCTTCTTGTTCTACATGCTGTTTGCCAACCATCATTGCGTCCTCAAAAGATGATCAACAAAG...

Protein

Download Protein FASTA

271 aa · LXL04_012449|LXL04_012449|OH1004|PROTEIN

MKLKIQGLPTKQHSCGLNIHICYIPSSRQIKPWKRLLPNSTPMAVSISSLPFSSPTLSTRLNLPLKPSCSTCCLPTIIASSKDDQQSKLGNCKRRSILLGVGASTLLPTKLVFAQEKPANYDEFVDLKDGYSYYYPSDWREFDFRGHDSAFKDRYLQLQNVRLSFIPTDKTDIHDMGPIEKVVANLVKHVYSTPTQVPDVFDMQERTTDGKTYYTFEYTLTSPNFSRAAFATIAVGNGRYYTLIVGANERRWRRVRNQLK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012449`
TK1151 ID	TkA02G560750
OH-1004 ID	LXL04_012449
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 84.762 / OH-1004 98.524 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012449

Location Chr03:12378625-12380189 (+)

Description Similar to PNSL1: Photosynthetic NDH subunit of lumenal location 1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g39470`	NDH shuttles electrons from NAD(P)H:plastoquinone, via FMN and iron-sulfur (Fe-S) centers, to quinones in the photosynthetic chain and possibly in a chloroplast respiratory chain.	Distinct functions for the two PsbP-like proteins PPL1 and PPL2 in the chloroplast thylakoid lumen of Arabidopsis.2007 · DOI: 10.1104/pp.107.105866
`At3g55330`	Required for efficient repair of photodamaged PSII, but not tightly associated with the complex.	Distinct functions for the two PsbP-like proteins PPL1 and PPL2 in the chloroplast thylakoid lumen of Arabidopsis.2007 · DOI: 10.1104/pp.107.105866
`At4g15510`	Photosystem I assembly factor that assists the proper folding and integration of PsaB and PsaA into the thylakoid membrane.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012449 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015979 photosynthesis Biological Process

GO:0048564 photosystem I assembly Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009543 chloroplast thylakoid lumen Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0009654 photosystem II oxygen evolving complex Cellular Component

GO:0019898 extrinsic component of membrane Cellular Component

GO:0031977 thylakoid lumen Cellular Component

GO:0042651 thylakoid membrane Cellular Component

KEGG gene cross-reference

ath:AT2G39470

ath:AT3G55330

ath:AT4G15510

syn:sll1418

tel:tlr2075

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.984

Rank 1 · LXL04_012449 · OH-1004

Mitochondrion0.023

Rank 2 · LXL04_012449 · OH-1004

Nucleus0.016

Rank 3 · LXL04_012449 · OH-1004

Cytoplasm0.013

Rank 4 · LXL04_012449 · OH-1004

Cell membrane0.010

Rank 5 · LXL04_012449 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01789.23PsbP120-268 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012449	`PF01789.23`	PsbP	120	268	9.6e-47	159.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80634`	Arabidopsis thaliana	Photosynthetic NDH subunit of lumenal location 1, chloroplastic	56.667%	Swiss-Prot	strong database homology
`P82538`	Arabidopsis thaliana	PsbP-like protein 1, chloroplastic	40.331%	Swiss-Prot	moderate database homology
`O23403`	Arabidopsis thaliana	PsbP domain-containing protein 1, chloroplastic	23.853%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card