LXL04_011666 | RubberDandelionOmics

Gene overview

LXL04_011666

Reference: OH-1004 Chr: Chr02 Coordinates: 169076186-169085754 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4617 bp · LXL04_011666|LXL04_011666|OH1004|cDNA

ATGGCGAACCTCCCAATTCTACAATTTGAAGACAAGATATTGGAAACCGTGCATCAGAACCCGGTAGTGGTGGTAATTGGCGAGACAGGTTCAGGGAAGAGCACTCAACTCTCTCAGATTTTACACAGAAGTGGCTACACAGAGGCCGGAATTATCGCCGTCACCCAGCCCCGCCGTGTTGCCGCCGTCTCTGTTTCTAGAAGGGTTGCACAGGAGCTTGGTGTCCGGCTGGGCGATGAAGTTGGTTACGCTATAAGATT...

CDS

Download CDS FASTA

4617 bp · LXL04_011666|LXL04_011666|OH1004|CDS

ATGGCGAACCTCCCAATTCTACAATTTGAAGACAAGATATTGGAAACCGTGCATCAGAACCCGGTAGTGGTGGTAATTGGCGAGACAGGTTCAGGGAAGAGCACTCAACTCTCTCAGATTTTACACAGAAGTGGCTACACAGAGGCCGGAATTATCGCCGTCACCCAGCCCCGCCGTGTTGCCGCCGTCTCTGTTTCTAGAAGGGTTGCACAGGAGCTTGGTGTCCGGCTGGGCGATGAAGTTGGTTACGCTATAAGATT...

Protein

Download Protein FASTA

1538 aa · LXL04_011666|LXL04_011666|OH1004|PROTEIN

MANLPILQFEDKILETVHQNPVVVVIGETGSGKSTQLSQILHRSGYTEAGIIAVTQPRRVAAVSVSRRVAQELGVRLGDEVGYAIRFEDRTSERTCIKYLTDGVLLRESLSDPELKQYSVVILDEAHERSLNTDILMGLMKRLIKLRSSNLKVLITSATLDGEKVSRFFSECPVLNVPGKLFPVEILYSVEQPKSYIDSSLKKAIDIHVNEPEGDILIFMTGQDDIEKLVSKLEERIQSLEVGSCMDAIVLPLHGSLPPE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011666`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011666

Location Chr02:169076186-169085754 (-)

Description Similar to URE: Urease

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g67550`	Urea hydrolase involved in nitrogen recycling from ureide, purine, and arginine catabolism.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0234800`	Urea hydrolase involved in nitrogen recycling from ureide, purine, and arginine catabolism.	No verified direct reference in this release
`UniProt: E0ZS48`	Urea hydrolase involved in nitrogen recycling from ureide, purine, and arginine catabolism.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011666 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0043419 urea catabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0035550 urease complex Cellular Component

GO:0009039 urease activity Molecular Function

GO:0016151 nickel cation binding Molecular Function

GO:0090729 toxin activity Molecular Function

KEGG gene cross-reference

ath:AT1G67550

gmx:547672

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.470

Rank 1 · LXL04_011666 · OH-1004

Nucleus0.282

Rank 2 · LXL04_011666 · OH-1004

Mitochondrion0.138

Rank 3 · LXL04_011666 · OH-1004

Peroxisome0.077

Rank 4 · LXL04_011666 · OH-1004

Plastid0.077

Rank 5 · LXL04_011666 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270.36DEAD12-166 aa

PF13401.13AAA_2219-139 aa

PF00271.38Helicase_C205-335 aa

PF04408.30WHD_HA2400-428 aa

PF21010.3HA2_C429-491 aa

PF07717.23OB_NTP_bind559-640 aa

PF00547.24Urease_gamma702-801 aa

PF00699.26Urease_beta834-928 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011666	`PF00270.36`	DEAD	12	166	8.9e-08	32.8
LXL04_011666	`PF13401.13`	AAA_22	19	139	5.4e-08	33.9
LXL04_011666	`PF00271.38`	Helicase_C	205	335	5.8e-12	46.5
LXL04_011666	`PF04408.30`	WHD_HA2	400	428	7.5e-12	45.7
LXL04_011666	`PF21010.3`	HA2_C	429	491	1.3e-08	35.9
LXL04_011666	`PF07717.23`	OB_NTP_bind	559	640	1.6e-21	77.0
LXL04_011666	`PF00547.24`	Urease_gamma	702	801	4.5e-42	143.2
LXL04_011666	`PF00699.26`	Urease_beta	834	928	3.5e-40	136.7
LXL04_011666	`PF18473.7`	Urease_linker	933	961	1.9e-08	34.7
LXL04_011666	`PF00449.27`	Urease_alpha	971	1090	1.6e-56	190.5
LXL04_011666	`PF01979.27`	Amidohydro_1	1096	1421	8.6e-80	269.3
LXL04_011666	`PF07969.18`	Amidohydro_3	1352	1423	9.2e-08	32.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SR52`	Arabidopsis thaliana	Urease	76.492%	Swiss-Prot	moderate database homology
`B9GCH9`	Oryza sativa subsp. japonica	Urease	76.066%	Swiss-Prot	moderate database homology
`E0ZS48`	Oryza sativa subsp. indica	Urease	76.066%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card