LXL04_010978 | RubberDandelionOmics

Gene overview

LXL04_010978

Reference: OH-1004 Chr: Chr02 Coordinates: 156060622-156063417 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1440 bp · LXL04_010978|LXL04_010978|OH1004|cDNA

ATGGCAGATGGCACCATCACCGGAGATTCCTCCATTTCATATTCATCTCTCATCTTTCCAAAACCTAGACACAAACggaaagagaaagagaaagagaaagGCCCAATTACACAATTCGTCTTTCCTGCTCTTTCTTCGTCGTTTCATCGTTTTTCGAATGCTACTTTTGTCAGAGTGATTCTTCTACAAATGCTAAACTCCAACAAGCCAAGAACTCAGCCAAGGCCTAACAGGTCTTATGCTTTAGGAGGTGTAGATCA...

CDS

Download CDS FASTA

1440 bp · LXL04_010978|LXL04_010978|OH1004|CDS

ATGGCAGATGGCACCATCACCGGAGATTCCTCCATTTCATATTCATCTCTCATCTTTCCAAAACCTAGACACAAACGGAAAGAGAAAGAGAAAGAGAAAGGCCCAATTACACAATTCGTCTTTCCTGCTCTTTCTTCGTCGTTTCATCGTTTTTCGAATGCTACTTTTGTCAGAGTGATTCTTCTACAAATGCTAAACTCCAACAAGCCAAGAACTCAGCCAAGGCCTAACAGGTCTTATGCTTTAGGAGGTGTAGATCA...

Protein

Download Protein FASTA

479 aa · LXL04_010978|LXL04_010978|OH1004|PROTEIN

MADGTITGDSSISYSSLIFPKPRHKRKEKEKEKGPITQFVFPALSSSFHRFSNATFVRVILLQMLNSNKPRTQPRPNRSYALGGVDHTEPIKKKGFVRKIIFASFLVALCIFMLKQSPSFRNPSPFSRHETGVTHVLVTGGAGYIGSHATLRLLKDSYRVTIVDNLSRGNIGAVKVLQDMFPQPGRLQFIYADLGDAKAVNKIFSENAFDAVIHFAAVAYVGESTLDPLKYYHNITSNTLTVLEAMSTHNVNTLIYSSTC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010978`
TK1151 ID	TkA03G559480
OH-1004 ID	LXL04_010978
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 48.852 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010978

Location Chr02:156060622-156063417 (+)

Description Similar to MUR4: UDP-arabinose 4-epimerase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g30620`	Acts as a UDP-D-xylose 4-epimerase but lacks both UDP-D- glucose and UDP-D-glucuronic acid 4-epimerase activities in vitro.	The biosynthesis of L-arabinose in plants: molecular cloning and characterization of a Golgi-localized UDP-D-xylose 4-epimerase encoded by the MUR4 gene of Arabidopsis.2003 · DOI: 10.1105/tpc.008425
`At4g20460`	Probable UDP-arabinose 4-epimerase 3.	No verified direct reference in this release
`At2g34850`	Putative UDP-arabinose 4-epimerase 2.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0139400`	Probable UDP-arabinose 4-epimerase 1.	No verified direct reference in this release
`Os04g0618200`	Probable UDP-arabinose 4-epimerase 2.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010978 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006012 galactose metabolic process Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009832 plant-type cell wall biogenesis Biological Process

GO:0019567 arabinose biosynthetic process Biological Process

GO:0033358 UDP-L-arabinose biosynthetic process Biological Process

GO:0045227 capsule polysaccharide biosynthetic process Biological Process

GO:0048868 pollen tube development Biological Process

GO:0000138 Golgi trans cisterna Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0032580 Golgi cisterna membrane Cellular Component

GO:0003978 UDP-glucose 4-epimerase activity Molecular Function

GO:0050373 UDP-arabinose 4-epimerase activity Molecular Function

KEGG gene cross-reference

ath:AT1G30620

ath:AT2G34850

ath:AT4G20460

dosa:Os07g0139400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.391

Rank 1 · LXL04_010978 · OH-1004

Endoplasmic reticulum0.204

Rank 2 · LXL04_010978 · OH-1004

Lysosome / Vacuole0.175

Rank 3 · LXL04_010978 · OH-1004

Cytoplasm0.114

Rank 4 · LXL04_010978 · OH-1004

Extracellular0.098

Rank 5 · LXL04_010978 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04321.24RmlD_sub_bind135-313 aa

PF01370.28Epimerase136-397 aa

PF02719.22Polysacc_synt_2136-316 aa

PF16363.12GDP_Man_Dehyd137-451 aa

PF01073.263Beta_HSD137-296 aa

PF07993.19NAD_binding_4138-318 aa

PF13460.13NAD_binding_10140-312 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010978	`PF04321.24`	RmlD_sub_bind	135	313	1.4e-12	48.0
LXL04_010978	`PF01370.28`	Epimerase	136	397	1.7e-53	182.2
LXL04_010978	`PF02719.22`	Polysacc_synt_2	136	316	1.3e-14	54.8
LXL04_010978	`PF16363.12`	GDP_Man_Dehyd	137	451	2.4e-54	185.8
LXL04_010978	`PF01073.26`	3Beta_HSD	137	296	3.5e-14	53.2
LXL04_010978	`PF07993.19`	NAD_binding_4	138	318	1.9e-07	31.3
LXL04_010978	`PF13460.13`	NAD_binding_10	140	312	2.4e-08	34.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SA77`	Arabidopsis thaliana	UDP-arabinose 4-epimerase 1	78.484%	Swiss-Prot	strong database homology
`Q9SUN3`	Arabidopsis thaliana	Probable UDP-arabinose 4-epimerase 3	78.345%	Swiss-Prot	strong database homology
`O64749`	Arabidopsis thaliana	Putative UDP-arabinose 4-epimerase 2	76.642%	Swiss-Prot	strong database homology
`Q8H930`	Oryza sativa subsp. japonica	Probable UDP-arabinose 4-epimerase 1	75.179%	Swiss-Prot	strong database homology
`Q8H0B6`	Oryza sativa subsp. japonica	Probable UDP-arabinose 4-epimerase 2	79.487%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card