LXL04_010397 | RubberDandelionOmics

Gene overview

LXL04_010397

Reference: OH-1004 Chr: Chr02 Coordinates: 146034009-146035809 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1314 bp · LXL04_010397|LXL04_010397|OH1004|cDNA

ATGGCGCTCCGCCAACTCCGGCGTACAATAACCACCACCACCAGCAAACTCCCAATATTATACaactccaccaccaccacctccgaCGATTGCGTTACCCTCCAGCTACTCTCATGGGGGCGAGGCTCTTCAGGTCAACTCGGTAACGGTAAAGAAGAATCACAACTATATCCTTCTCCCTTTTCATCACTCATTCTCCCTCCTCTCTCTTACCGTATCTCTTCATCGACTACATCCCACAATAGCAAAGACGACCAATT...

CDS

Download CDS FASTA

1308 bp · LXL04_010397|LXL04_010397|OH1004|CDS

ATGGCGCTCCGCCAACTCCGGCGTACAATAACCACCACCACCAGCAAACTCCCAATATTATACAACTCCACCACCACCACCTCCGACGATTGCGTTACCCTCCAGCTACTCTCATGGGGGCGAGGCTCTTCAGGTCAACTCGGTAACGGTAAAGAAGAATCACAACTATATCCTTCTCCCTTTTCATCACTCATTCTCCCTCCTCTCTCTTACCGTATCTCTTCATCGACTACATCCCACAATAGCAAAGACGACCAATT...

Protein

Download Protein FASTA

435 aa · LXL04_010397|LXL04_010397|OH1004|PROTEIN

MALRQLRRTITTTTSKLPILYNSTTTTSDDCVTLQLLSWGRGSSGQLGNGKEESQLYPSPFSSLILPPLSYRISSSTTSHNSKDDQLEIGIACGLFHSAVLIDGKLWIWGKGDGGRLGFGHENTVFRPTLNSNLESVKSIAPGGLHSIALDSLGQVYSWGYGGFGALGHSVYTRELSPKRVQGTWEGRITQIATSGTHTAAITETGEVYTWGRDEGEGRLGLGSTRGQNEVGGLSIPTKVKALQVPVVSVTCGGFFTTVI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010397`
TK1151 ID	TkA03G525590
OH-1004 ID	LXL04_010397
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010397

Location Chr02:146034009-146035809 (+)

Description Similar to RUG3: RCC1 domain-containing protein RUG3, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g60870`	Regulates DNA damage response (DDR) synergistically with ATM.	The RCC1 family protein RUG3 is required for splicing of nad2 and complex I biogenesis in mitochondria of Arabidopsis thaliana.2011 · DOI: 10.1111/j.1365-313x.2011.04658.x RUG3 and ATM synergistically regulate the alternative splicing of mitochondrial nad2 and the DNA damage response in Arabidopsis thaliana.2017 · DOI: 10.1038/srep43897 RUG3 is a negative regulator of plant responses to ABA in Arabidopsis thaliana.2017 · DOI: 10.1080/15592324.2017.1333217
`At5g63860`	UV-B specific signaling component that acts as a UV-B photoreceptor and plays a key role in establishing UV-protective responses in plants.	A UV-B-specific signaling component orchestrates plant UV protection.2005 · DOI: 10.1073/pnas.0507187102 UV-B promotes rapid nuclear translocation of the Arabidopsis UV-B specific signaling component UVR8 and activates its function in the nucleus.2007 · DOI: 10.1105/tpc.107.053330 UV-B signaling pathways with different fluence-rate response profiles are distinguished in mature Arabidopsis leaf tissue by requirement for UVR8, HY5, and HYH.2008 · DOI: 10.1104/pp.107.108456 Interaction of COP1 and UVR8 regulates UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis.2009 · DOI: 10.1038/emboj.2009.4 UVR8 in Arabidopsis thaliana regulates multiple aspects of cellular differentiation during leaf development in response to ultraviolet B radiation.2009 · DOI: 10.1111/j.1469-8137.2009.02855.x Negative feedback regulation of UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis.2010 · DOI: 10.1073/pnas.0914532107 Functional interaction of the circadian clock and UV RESISTANCE LOCUS 8-controlled UV-B signaling pathways in Arabidopsis thaliana.2011 · DOI: 10.1111/j.1365-313x.2011.04573.x Perception of UV-B by the Arabidopsis UVR8 protein.2011 · DOI: 10.1126/science.1200660 UVR8 mediates UV-B-induced Arabidopsis defense responses against Botrytis cinerea by controlling sinapate accumulation.2012 · DOI: 10.1093/mp/sss025 C-terminal region of the UV-B photoreceptor UVR8 initiates signaling through interaction with the COP1 protein.2012 · DOI: 10.1073/pnas.1210898109 In vivo function of tryptophans in the Arabidopsis UV-B photoreceptor UVR8.2012 · DOI: 10.1105/tpc.112.101451 The UV-B photoreceptor UVR8 promotes photosynthetic efficiency in Arabidopsis thaliana exposed to elevated levels of UV-B.2012 · DOI: 10.1007/s11120-012-9785-y

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010397 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006974 DNA damage response Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0032981 mitochondrial respiratory chain complex I assembly Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0050821 protein stabilization Biological Process

KEGG gene cross-reference

ath:AT5G60870

hsa:8924

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.743

Rank 1 · LXL04_010397 · OH-1004

Plastid0.140

Rank 2 · LXL04_010397 · OH-1004

Cytoplasm0.102

Rank 3 · LXL04_010397 · OH-1004

Nucleus0.060

Rank 4 · LXL04_010397 · OH-1004

Peroxisome0.045

Rank 5 · LXL04_010397 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25390.2WD40_RLD35-344 aa

PF00415.25RCC135-64 aa

PF00415.25RCC1103-150 aa

PF13540.13RCC1_2137-165 aa

PF00415.25RCC1154-202 aa

PF13540.13RCC1_2189-214 aa

PF00415.25RCC1206-260 aa

PF13540.13RCC1_2247-275 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010397	`PF25390.2`	WD40_RLD	35	344	2.5e-83	281.1
LXL04_010397	`PF00415.25`	RCC1	35	64	1.1e-81	269.9
LXL04_010397	`PF00415.25`	RCC1	103	150	1.1e-81	269.9
LXL04_010397	`PF13540.13`	RCC1_2	137	165	2.9e-48	161.2
LXL04_010397	`PF00415.25`	RCC1	154	202	1.1e-81	269.9
LXL04_010397	`PF13540.13`	RCC1_2	189	214	2.9e-48	161.2
LXL04_010397	`PF00415.25`	RCC1	206	260	1.1e-81	269.9
LXL04_010397	`PF13540.13`	RCC1_2	247	275	2.9e-48	161.2
LXL04_010397	`PF00415.25`	RCC1	263	312	1.1e-81	269.9
LXL04_010397	`PF25384.2`	Alsin_RLD	264	333	1.8e-13	51.1
LXL04_010397	`PF13540.13`	RCC1_2	299	328	2.9e-48	161.2
LXL04_010397	`PF00415.25`	RCC1	315	364	1.1e-81	269.9
LXL04_010397	`PF25390.2`	WD40_RLD	337	426	2.5e-83	281.1
LXL04_010397	`PF13540.13`	RCC1_2	351	380	2.9e-48	161.2
LXL04_010397	`PF00415.25`	RCC1	367	424	1.1e-81	269.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FJG9`	Arabidopsis thaliana	RCC1 domain-containing protein RUG3, mitochondrial	62.850%	Swiss-Prot	strong database homology
`Q9FN03`	Arabidopsis thaliana	Ultraviolet-B receptor UVR8	31.398%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card