LXL04_010297 | RubberDandelionOmics

Gene overview

LXL04_010297

Reference: OH-1004 Chr: Chr02 Coordinates: 143855345-143858848 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1824 bp · LXL04_010297|LXL04_010297|OH1004|cDNA

TTAACCCTTTTGTTTTCGTCTTTTGAGTATTTTTTAACATCAAGAGAGGCGCTCTCCAAAAACCGTCCATTTACATCTCTATTTTTCCCACTCAGACCACACTCGGGATTCGCCTACTCAGATCAGTACCGACTGCTACCACCAGCAATGGCTGAAGCTTCCGACGACACAAGAGACATCGAAAAGCTCTATGAGTACGGTGAACGACTCAACGAAGCTAAAGACAAGTCTCAGAACGTGGACGACTATAAGAATATTAT...

CDS

Download CDS FASTA

1815 bp · LXL04_010297|LXL04_010297|OH1004|CDS

TTGTTTTCGTCTTTTGAGTATTTTTTAACATCAAGAGAGGCGCTCTCCAAAAACCGTCCATTTACATCTCTATTTTTCCCACTCAGACCACACTCGGGATTCGCCTACTCAGATCAGTACCGACTGCTACCACCAGCAATGGCTGAAGCTTCCGACGACACAAGAGACATCGAAAAGCTCTATGAGTACGGTGAACGACTCAACGAAGCTAAAGACAAGTCTCAGAACGTGGACGACTATAAGAATATTATCGCCTCAGC...

Protein

Download Protein FASTA

604 aa · LXL04_010297|LXL04_010297|OH1004|PROTEIN

MFSSFEYFLTSREALSKNRPFTSLFFPLRPHSGFAYSDQYRLLPPAMAEASDDTRDIEKLYEYGERLNEAKDKSQNVDDYKNIIASATSTSLKARQLAAQLIPRFFKFFPGLSGTAVDAHLDLCEAEELGIRVQAIRGLPLFCKDTPEHISKIVDILAQLLIAEENVERDAVHKALLSLLRQDVKASLTALFKHIESVEEPIPDDNRERTLIFIRDKVFPIKSELLKPQEQMERLITDLIKKSLQDVTGAEFKMFMDFLK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010297`
TK1151 ID	TkA03G518200
OH-1004 ID	LXL04_010297
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.700
Protein coverage (%)	TK1151 99.507 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010297

Location Chr02:143855345-143858848 (+)

Description Similar to API5: Apoptosis inhibitor 5-like protein API5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0313400`	Putative anti-apoptotic factor involved in the regulation of tapetal programmed cell death (PCD) and degeneration during anther development.	Rice APOPTOSIS INHIBITOR5 coupled with two DEAD-box adenosine 5'-triphosphate-dependent RNA helicases regulates tapetum degeneration.2011 · DOI: 10.1105/tpc.110.082636

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010297 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009555 pollen development Biological Process

GO:0043067 regulation of programmed cell death Biological Process

GO:0005634 nucleus Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0016020 membrane Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0017134 fibroblast growth factor binding Molecular Function

KEGG gene cross-reference

dosa:Os02g0313400

hsa:8539

mmu:11800

pon:100173613

xla:446672

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.767

Rank 1 · LXL04_010297 · OH-1004

Cytoplasm0.286

Rank 2 · LXL04_010297 · OH-1004

Endoplasmic reticulum0.054

Rank 3 · LXL04_010297 · OH-1004

Cell membrane0.046

Rank 4 · LXL04_010297 · OH-1004

Golgi apparatus0.035

Rank 5 · LXL04_010297 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05918.18API557-600 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010297	`PF05918.18`	API5	57	600	3.2e-238	792.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6Z6S1`	Oryza sativa subsp. japonica	Apoptosis inhibitor 5-like protein API5	63.118%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card