LXL04_009706 | RubberDandelionOmics

Gene overview

LXL04_009706

Reference: OH-1004 Chr: Chr02 Coordinates: 131783483-131785662 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

958 bp · LXL04_009706|LXL04_009706|OH1004|cDNA

ATGAAGCTACACGTTGAGTATGGTGGAATAAAAAGCGTTCCAAATCAGCCTAACAAAAGTTCCTCACAAAATAAAGCTGCACCTTCAAGCTCAAATGCTCTTGTGCTATCAGGAACCGAGACTTCCAAAAAGGGTGATTTAACAACTACCGCTTCTGCTCAACCAAAGAACCTGAATCTTTCAACTGCAGCCCTTATGGAAAGAATCCCCAGCAGGTGGCCACGTCCTGCATGGCATGCTCCATGGAAGAACTATAGAGT...

CDS

Download CDS FASTA

714 bp · LXL04_009706|LXL04_009706|OH1004|CDS

ATGAAGCTACACGTTGAGTATGGTGGAATAAAAAGCGTTCCAAATCAGCCTAACAAAAGTTCCTCACAAAATAAAGCTGCACCTTCAAGCTCAAATGCTCTTGTGCTATCAGGAACCGAGACTTCCAAAAAGGGTGATTTAACAACTACCGCTTCTGCTCAACCAAAGAACCTGAATCTTTCAACTGCAGCCCTTATGGAAAGAATCCCCAGCAGGTGGCCACGTCCTGCATGGCATGCTCCATGGAAGAACTATAGAGT...

Protein

Download Protein FASTA

237 aa · LXL04_009706|LXL04_009706|OH1004|PROTEIN

MKLHVEYGGIKSVPNQPNKSSSQNKAAPSSSNALVLSGTETSKKGDLTTTASAQPKNLNLSTAALMERIPSRWPRPAWHAPWKNYRVISGHLGWVRSIAFDPSNQWFCTGLAVSTRHTYMFSAGDDKLVKCWDLEKNKVIRLYHRHLSGVYCLALHPTINVLLTGGRDSVCGGLEAVLDKDENMSIGQRDALLLFRTLCKIMMKLLQRLVFFLSNFYKDFWRVLVTHSPTTSISLTL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009706`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009706

Location Chr02:131783483-131785662 (+)

Description Similar to PRL1: Protein pleiotropic regulatory locus 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g15900`	Pleiotropic regulator of glucose, stress and hormone responses.	Regulatory interaction of PRL1 WD protein with Arabidopsis SNF1-like protein kinases.1999 · DOI: 10.1073/pnas.96.9.5322 SKP1-SnRK protein kinase interactions mediate proteasomal binding of a plant SCF ubiquitin ligase.2001 · DOI: 10.1093/emboj/20.11.2742 Regulation of plant innate immunity by three proteins in a complex conserved across the plant and animal kingdoms.2007 · DOI: 10.1101/gad.1559607 Signaling from an altered cell wall to the nucleus mediates sugar-responsive growth and development in Arabidopsis thaliana.2007 · DOI: 10.1105/tpc.106.049965 Characterization of Arabidopsis and rice DWD proteins and their roles as substrate receptors for CUL4-RING E3 ubiquitin ligases.2008 · DOI: 10.1105/tpc.107.055418 Modulation of O-mediated retrograde signaling by the PLEIOTROPIC RESPONSE LOCUS 1 (PRL1) protein, a central integrator of stress and energy signaling.2009 · DOI: 10.1111/j.1365-313x.2009.03935.x Pleiotropic regulatory locus 1 (PRL1) integrates the regulation of sugar responses with isoprenoid metabolism in Arabidopsis.2010 · DOI: 10.1093/mp/ssp100 Pleiotropic control of glucose and hormone responses by PRL1, a nuclear WD protein, in Arabidopsis.1998 · DOI: 10.1101/gad.12.19.3059
`At3g16650`	Pleiotropic regulator.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009706 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006396 RNA processing Biological Process

GO:0009749 response to glucose Biological Process

GO:0009755 hormone-mediated signaling pathway Biological Process

GO:0010154 fruit development Biological Process

GO:0010182 sugar mediated signaling pathway Biological Process

GO:0010215 cellulose microfibril organization Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045087 innate immune response Biological Process

GO:0045292 mRNA cis splicing, via spliceosome Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

KEGG gene cross-reference

ath:AT3G16650

ath:AT4G15900

cnb:CNBG1700

cne:CNG03060

spo:3361260

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.639

Rank 1 · LXL04_009706 · OH-1004

Cytoplasm0.284

Rank 2 · LXL04_009706 · OH-1004

Mitochondrion0.055

Rank 3 · LXL04_009706 · OH-1004

Cell membrane0.054

Rank 4 · LXL04_009706 · OH-1004

Endoplasmic reticulum0.047

Rank 5 · LXL04_009706 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00400.39WD4083-133 aa

PF24814.2WD40_Prp1988-171 aa

PF23381.2Beta-prop_IFT122_1st89-166 aa

PF25173.2Beta-prop_WDR3_1st109-169 aa

PF24807.2WD40_CDC20-Fz109-166 aa

PF23414.2Beta-prop_EML_2110-168 aa

PF25175.2Beta-prop_WDR5111-169 aa

PF25172.2Beta-prop_WDR3_2nd113-170 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009706	`PF00400.39`	WD40	83	133	2.2e-13	50.8
LXL04_009706	`PF24814.2`	WD40_Prp19	88	171	2.5e-08	34.0
LXL04_009706	`PF23381.2`	Beta-prop_IFT122_1st	89	166	2.4e-07	31.1
LXL04_009706	`PF25173.2`	Beta-prop_WDR3_1st	109	169	4.3e-09	37.0
LXL04_009706	`PF24807.2`	WD40_CDC20-Fz	109	166	4.5e-06	26.9
LXL04_009706	`PF23414.2`	Beta-prop_EML_2	110	168	1.1e-06	29.0
LXL04_009706	`PF25175.2`	Beta-prop_WDR5	111	169	3.9e-10	40.2
LXL04_009706	`PF25172.2`	Beta-prop_WDR3_2nd	113	170	1.5e-06	28.4
LXL04_009706	`PF25174.2`	Beta-prop_THOC3	117	170	2.1e-08	34.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42384`	Arabidopsis thaliana	Protein pleiotropic regulatory locus 1	53.448%	Swiss-Prot	strong database homology
`Q39190`	Arabidopsis thaliana	Protein pleiotropic regulator PRL2	50.000%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card