LXL04_009258 | RubberDandelionOmics

Gene overview

LXL04_009258

Reference: OH-1004 Chr: Chr02 Coordinates: 121452110-121454090 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1419 bp · LXL04_009258|LXL04_009258|OH1004|cDNA

ATGATGAAGGTCCCAGACCACCAAGTTGCAGGACACGTAGCTGGAGCTGGTAAACTCGGTCCTCTCGTAGACGATTCAGGTCGTTTCTACAAACCACTCCAAGACGGTACACGTGGAATAGAAGAAGTCTCCTTCTACGAATCCTTCACTTCCAACTCTCAAATCCCACAACAAATCCGTAAGTTCTTCCCCATCTTCTATGGCACCAAAGTCATGACCGCATCAACTGGAGACGAACACCCTCACATAATCCTCCAAGA...

CDS

Download CDS FASTA

1419 bp · LXL04_009258|LXL04_009258|OH1004|CDS

ATGATGAAGGTCCCAGACCACCAAGTTGCAGGACACGTAGCTGGAGCTGGTAAACTCGGTCCTCTCGTAGACGATTCAGGTCGTTTCTACAAACCACTCCAAGACGGTACACGTGGAATAGAAGAAGTCTCCTTCTACGAATCCTTCACTTCCAACTCTCAAATCCCACAACAAATCCGTAAGTTCTTCCCCATCTTCTATGGCACCAAAGTCATGACCGCATCAACTGGAGACGAACACCCTCACATAATCCTCCAAGA...

Protein

Download Protein FASTA

472 aa · LXL04_009258|LXL04_009258|OH1004|PROTEIN

MMKVPDHQVAGHVAGAGKLGPLVDDSGRFYKPLQDGTRGIEEVSFYESFTSNSQIPQQIRKFFPIFYGTKVMTASTGDEHPHIILQDLVSSRTSPSLMDIKIGARTWAPEATEAYITKCMKKDRESTSVSLGYRISGLRAFIDDDLGFYKPERDVMRTASPDDVRMFLMKFVSSNPESESKPDCCLAKSVYGGDNGILSQLVELKTWFEGQTMYHFYACSVLFMFEKGLALKGDGQNAEVKLIDFAHVEEGKGVIDHNFL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009258`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009258

Location Chr02:121452110-121454090 (-)

Description Similar to IPK2a: Inositol polyphosphate multikinase alpha

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g07370`	Inositol phosphate kinase with a broad substrate specificity.	No verified direct reference in this release
`At5g61760`	Inositol phosphate kinase with a broad substrate specificity.	No verified direct reference in this release
`At5g61750`	May play a role in plant defense.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0523800`	Inositol phosphate kinase with a broad substrate specificity.	No verified direct reference in this release
`UniProt: A2X5H5`	Inositol phosphate kinase with a broad substrate specificity.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009258 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009555 pollen development Biological Process

GO:0009749 response to glucose Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010264 myo-inositol hexakisphosphate biosynthetic process Biological Process

GO:0010497 plasmodesmata-mediated intercellular transport Biological Process

GO:0032958 inositol phosphate biosynthetic process Biological Process

GO:2000280 regulation of root development Biological Process

GO:0005576 extracellular region Cellular Component

KEGG gene cross-reference

ath:AT5G07370

ath:AT5G61750

ath:AT5G61760

dosa:Os02g0523800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.466

Rank 1 · LXL04_009258 · OH-1004

Nucleus0.266

Rank 2 · LXL04_009258 · OH-1004

Lysosome / Vacuole0.124

Rank 3 · LXL04_009258 · OH-1004

Cell membrane0.118

Rank 4 · LXL04_009258 · OH-1004

Endoplasmic reticulum0.114

Rank 5 · LXL04_009258 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03770.23IPK82-268 aa

PF00190.29Cupin_1323-436 aa

PF07883.18Cupin_2356-421 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009258	`PF03770.23`	IPK	82	268	5.8e-42	144.5
LXL04_009258	`PF00190.29`	Cupin_1	323	436	6.2e-32	111.0
LXL04_009258	`PF07883.18`	Cupin_2	356	421	1.3e-09	38.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LY23`	Arabidopsis thaliana	Inositol polyphosphate multikinase alpha	54.982%	Swiss-Prot	moderate database homology
`Q9FLT2`	Arabidopsis thaliana	Inositol polyphosphate multikinase beta	53.455%	Swiss-Prot	moderate database homology
`Q9FLT3`	Arabidopsis thaliana	Germin-like protein subfamily 3 member 4	55.500%	Swiss-Prot	weak database homology
`Q6H545`	Oryza sativa subsp. japonica	Inositol polyphosphate multikinase IPK2	48.000%	Swiss-Prot	moderate database homology
`A2X5H5`	Oryza sativa subsp. indica	Inositol polyphosphate multikinase IPK2	48.000%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card