Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3639 bp · LXL04_008733|LXL04_008733|OH1004|cDNA
ATGGAAGAACGAGAGACGGAAATTGAAGTCCGAGCCCTAACCGGTGAAACGATCACAGTCTCAATTTCCTCGAGTAGGACAATTCAAGAACTCAAGCTTCTCCTTAAACAAATATTTCCTCCCGCAACCACCTCCTCGAACTTCCACCTTTTTCTCAAGGGCACGAAACTAAGTTTGCAGAGTCAGATAAGTAGTACCTGGATTTCCGATGGAGAATTTATTGTTCTTCTTCCGTTCACAAAGAAGGACAAACAGAAAAC...
3639 bp · LXL04_008733|LXL04_008733|OH1004|CDS
ATGGAAGAACGAGAGACGGAAATTGAAGTCCGAGCCCTAACCGGTGAAACGATCACAGTCTCAATTTCCTCGAGTAGGACAATTCAAGAACTCAAGCTTCTCCTTAAACAAATATTTCCTCCCGCAACCACCTCCTCGAACTTCCACCTTTTTCTCAAGGGCACGAAACTAAGTTTGCAGAGTCAGATAAGTAGTACCTGGATTTCCGATGGAGAATTTATTGTTCTTCTTCCGTTCACAAAGAAGGACAAACAGAAAAC...
Protein
Download Protein FASTA1212 aa · LXL04_008733|LXL04_008733|OH1004|PROTEIN
MEERETEIEVRALTGETITVSISSSRTIQELKLLLKQIFPPATTSSNFHLFLKGTKLSLQSQISSTWISDGEFIVLLPFTKKDKQKTVEPSENDTNSQNFHQCSTSSFAESAWSDMMQDLSSLQDIEIDENQIYSEANNRSTESNTQNEAKKSLFDEALIELLNTLQSCDSDEPDEKSCQGFMQVLESVNCLSDLKTRNCMLMNANTRITESCGSASSSNPCTCPSWLKVHLKAFYFLNIYCSFLQVQQRKVTLLSLERG...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_008733 |
|---|---|
| TK1151 ID | TkA03G339860 |
| OH-1004 ID | LXL04_008733 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_008733 |
|---|---|
| Location | Chr02:107489530-107495372 (+) |
| Description | Similar to HRQ1: ATP-dependent helicase HRQ1 (Saccharomyces cerevisiae (strain ATCC 204508 / S288c) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006289 nucleotide-excision repair Biological Process GO:0032202 telomere assembly Biological Process GO:0032204 regulation of telomere maintenance Biological Process GO:0036297 interstrand cross-link repair Biological Process GO:0042275 error-free postreplication DNA repair Biological Process GO:0070914 UV-damage excision repair Biological Process GO:1901255 nucleotide-excision repair involved in interstrand cross-link repair Biological Process GO:0005634 nucleus Cellular Component GO:0035861 site of double-strand break Cellular Component GO:0000405 bubble DNA binding Molecular Function GO:0003676 nucleic acid binding Molecular Function GO:0003697 single-stranded DNA binding Molecular Function |
| KEGG gene cross-reference | bsu:BSU22220 mja:MJ_1574 msb:LJ00_30465 msm:MSMEG_6160 sce:YDR291W spo:2542036 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF04851.22ResIII462-600 aaPF00270.36DEAD465-635 aaPF00271.38Helicase_C713-818 aaPF22982.4WHD_HRQ1854-928 aaPF09369.16MZB1092-1173 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_008733 | PF04851.22 | ResIII | 462 | 600 | 7.3e-07 | 30.0 |
| LXL04_008733 | PF00270.36 | DEAD | 465 | 635 | 1.2e-29 | 103.9 |
| LXL04_008733 | PF00271.38 | Helicase_C | 713 | 818 | 1.3e-12 | 48.6 |
| LXL04_008733 | PF22982.4 | WHD_HRQ1 | 854 | 928 | 1e-13 | 52.8 |
| LXL04_008733 | PF09369.16 | MZB | 1092 | 1173 | 3.2e-20 | 73.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.