LXL04_008302 | RubberDandelionOmics

Gene overview

LXL04_008302

Reference: OH-1004 Chr: Chr02 Coordinates: 96141295-96143202 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

834 bp · LXL04_008302|LXL04_008302|OH1004|cDNA

ATGGGTGCGGCGGCGAGCTCGTCATCCTCGAGATCGAGCTCGCTGACGGTGGGGGAAAAAGTATGTGCGGCGTTCATACCGTGTGCGGTTATAGTTGAAGTTCTGATCTACAGCTTATTGTCCTGTTTCAATGCTCAGCGCAGCCGTCTGGTTAAACATGTGCAGACTTTTGACGAAGTTAGTCGTCTCGCTCGTAATTCTCCATTTTCGGTTAACGAAGTGGAAGCATTACGCGAATTGTTCAATAAGTTGAGCAATTC...

CDS

Download CDS FASTA

834 bp · LXL04_008302|LXL04_008302|OH1004|CDS

ATGGGTGCGGCGGCGAGCTCGTCATCCTCGAGATCGAGCTCGCTGACGGTGGGGGAAAAAGTATGTGCGGCGTTCATACCGTGTGCGGTTATAGTTGAAGTTCTGATCTACAGCTTATTGTCCTGTTTCAATGCTCAGCGCAGCCGTCTGGTTAAACATGTGCAGACTTTTGACGAAGTTAGTCGTCTCGCTCGTAATTCTCCATTTTCGGTTAACGAAGTGGAAGCATTACGCGAATTGTTCAATAAGTTGAGCAATTC...

Protein

Download Protein FASTA

277 aa · LXL04_008302|LXL04_008302|OH1004|PROTEIN

MGAAASSSSSRSSSLTVGEKVCAAFIPCAVIVEVLIYSLLSCFNAQRSRLVKHVQTFDEVSRLARNSPFSVNEVEALRELFNKLSNSIIMDGLIHKEELQLALFNSAGGENLFLNRVFDLFDEKQNGVIEFEEFVHVLSIFHPNAPMEQKIDFAFRLYDLRRTGYIEREEVREMIVATLKETGMVLSEEILEQIIDKARLLRFILIIQQSFILFVCFFFCFQTFMDADADMDGRISKDEWRNFVIYRPQLLKNMTLPSLR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008302`
TK1151 ID	TkA03G387360
OH-1004 ID	LXL04_008302
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	91.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008302

Location Chr02:96141295-96143202 (-)

Description Similar to CBL10: Calcineurin B-like protein 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g33000`	Acts as a calcium sensor.	SCABP8/CBL10, a putative calcium sensor, interacts with the protein kinase SOS2 to protect Arabidopsis shoots from salt stress.2007 · DOI: 10.1105/tpc.106.042291 The calcium sensor CBL10 mediates salt tolerance by regulating ion homeostasis in Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2007.03249.x Calcineurin B-like protein CBL10 directly interacts with AKT1 and modulates K+ homeostasis in Arabidopsis.2013 · DOI: 10.1111/tpj.12123

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0579600`	Acts as a calcium sensor.	No verified direct reference in this release
`Os01g0711500`	Acts as a calcium sensor.	No verified direct reference in this release
`Os12g0597000`	Acts as a calcium sensor.	A gibberellin-regulated calcineurin B in rice localizes to the tonoplast and is implicated in vacuole function.2005 · DOI: 10.1104/pp.105.062703
`Os12g0162400`	Acts as a calcium sensor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008302 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0019722 calcium-mediated signaling Biological Process

GO:0042538 hyperosmotic salinity response Biological Process

GO:0043266 regulation of potassium ion transport Biological Process

GO:0050801 monoatomic ion homeostasis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005768 endosome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0032578 aleurone grain membrane Cellular Component

GO:0005509 calcium ion binding Molecular Function

GO:0019900 kinase binding Molecular Function

KEGG gene cross-reference

ath:AT4G33000

dosa:Os01g0711500

dosa:Os12g0162400

dosa:Os12g0597000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.273

Rank 1 · LXL04_008302 · OH-1004

Cytoplasm0.264

Rank 2 · LXL04_008302 · OH-1004

Golgi apparatus0.189

Rank 3 · LXL04_008302 · OH-1004

Cell membrane0.175

Rank 4 · LXL04_008302 · OH-1004

Nucleus0.155

Rank 5 · LXL04_008302 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00036.39EF-hand_1114-139 aa

PF13405.13EF-hand_6114-139 aa

PF13499.13EF-hand_7148-197 aa

PF00036.39EF-hand_1151-175 aa

PF13202.13EF-hand_5223-244 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008302	`PF00036.39`	EF-hand_1	114	139	1.6e-16	59.3
LXL04_008302	`PF13405.13`	EF-hand_6	114	139	7.3e-15	53.9
LXL04_008302	`PF13499.13`	EF-hand_7	148	197	9.5e-15	55.4
LXL04_008302	`PF00036.39`	EF-hand_1	151	175	1.6e-16	59.3
LXL04_008302	`PF13202.13`	EF-hand_5	223	244	1.5e-12	47.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7FRS8`	Arabidopsis thaliana	Calcineurin B-like protein 10	59.779%	Swiss-Prot	strong database homology
`Q3HRN8`	Oryza sativa subsp. japonica	Calcineurin B-like protein 9	52.508%	Swiss-Prot	strong database homology
`Q3HRN7`	Oryza sativa subsp. japonica	Calcineurin B-like protein 10	52.174%	Swiss-Prot	strong database homology
`Q3HRP5`	Oryza sativa subsp. japonica	Calcineurin B-like protein 2	49.206%	Swiss-Prot	moderate database homology
`Q3HRP1`	Oryza sativa subsp. japonica	Calcineurin B-like protein 6	54.630%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card