LXL04_007456 | RubberDandelionOmics

Gene overview

LXL04_007456

Reference: OH-1004 Chr: Chr02 Coordinates: 49060520-49063037 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

996 bp · LXL04_007456|LXL04_007456|OH1004|cDNA

ATGGCGCCGACCAAATCTAAACCATCGAATTCAAAGAATTATTCAGAAAACTCAGGTGTTAACAAAAAAATATGGTTCTATTCGTTGTTGCTTACAATTCAATATGGTGCTCAGCCTCTCATCTCCAAACGCTGCATCGGGCGAGATGTGATTGTGACTTCATCTGTTTTGGCATGCGAGTTAGTAAAGGTTATTTGTGCAATTGGTCTAATGGCAAAAGATGGGAGTCTAAAAAGAGCAATGAAGGAATGGACTTTGAT...

CDS

Download CDS FASTA

996 bp · LXL04_007456|LXL04_007456|OH1004|CDS

ATGGCGCCGACCAAATCTAAACCATCGAATTCAAAGAATTATTCAGAAAACTCAGGTGTTAACAAAAAAATATGGTTCTATTCGTTGTTGCTTACAATTCAATATGGTGCTCAGCCTCTCATCTCCAAACGCTGCATCGGGCGAGATGTGATTGTGACTTCATCTGTTTTGGCATGCGAGTTAGTAAAGGTTATTTGTGCAATTGGTCTAATGGCAAAAGATGGGAGTCTAAAAAGAGCAATGAAGGAATGGACTTTGAT...

Protein

Download Protein FASTA

331 aa · LXL04_007456|LXL04_007456|OH1004|PROTEIN

MAPTKSKPSNSKNYSENSGVNKKIWFYSLLLTIQYGAQPLISKRCIGRDVIVTSSVLACELVKVICAIGLMAKDGSLKRAMKEWTLMGSLSASGLPAAIYALQNSLLQISYRNLDSLTFSMLNQTKLIFTAFFTYIILRQKQSYQQIGALLILILAAVLLSIGEGSRKNYGSDNRDEIVLYGIVPVLIASVLSGLASALCQWASQVKKHSSYLMTVEMSIVGSLCLLASISKSPDGQAMRQHGFFHGWTPLTFIPVFINA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007456`
TK1151 ID	TkA03G178780
OH-1004 ID	LXL04_007456
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007456

Location Chr02:49060520-49063037 (-)

Description Similar to ROCK1: UDP-N-acetylglucosamine transporter ROCK1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g65000`	Mediates the transport of UDP-linked acetylated hexosamines across the endoplasmic reticulum (ER) membrane.	Arabidopsis ROCK1 transports UDP-GlcNAc/UDP-GalNAc and regulates ER protein quality control and cytokinin activity.2015 · DOI: 10.1073/pnas.1419050112

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007456 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010584 pollen exine formation Biological Process

GO:0015739 sialic acid transport Biological Process

GO:0015789 UDP-N-acetylgalactosamine transmembrane transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:1902183 regulation of shoot apical meristem development Biological Process

GO:1904293 negative regulation of ERAD pathway Biological Process

GO:1990569 UDP-N-acetylglucosamine transmembrane transport Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT5G65000

bta:520918

cfa:442991

mmu:229782

rno:310808

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.627

Rank 1 · LXL04_007456 · OH-1004

Endoplasmic reticulum0.240

Rank 2 · LXL04_007456 · OH-1004

Cytoplasm0.083

Rank 3 · LXL04_007456 · OH-1004

Lysosome / Vacuole0.048

Rank 4 · LXL04_007456 · OH-1004

Cell membrane0.041

Rank 5 · LXL04_007456 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04142.22Nuc_sug_transp48-319 aa

PF16913.12PUNUT99-225 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007456	`PF04142.22`	Nuc_sug_transp	48	319	1.8e-33	116.7
LXL04_007456	`PF16913.12`	PUNUT	99	225	1.7e-10	41.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LES0`	Arabidopsis thaliana	UDP-N-acetylglucosamine transporter ROCK1	77.316%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card