LXL04_006505 | RubberDandelionOmics

Gene overview

LXL04_006505

Reference: OH-1004 Chr: Chr02 Coordinates: 12416234-12421101 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1961 bp · LXL04_006505|LXL04_006505|OH1004|cDNA

AGGGTTTATTGAAATCTTGTGAAATGGGGAAGAACAAGCATTTGGATTGGACAAGCCGATCGATCATCTCGTCTGGAGGTGATAGAGTTCCTCTAATCAGAAAAGAGGTCAAGAGAAATGATAATGAAATCGGGTCGTCAAATGGCCCAGCAACGGACCTTGAGTATGGGGACGCAGTACAGGCAGCAAATGTTGGATTTTCCAGGGTTCTACTTTTGGCAAAGCCTGATGCAGGGAGGCTCGTTATCGCGACAATTGCT...

CDS

Download CDS FASTA

1953 bp · LXL04_006505|LXL04_006505|OH1004|CDS

TTGAAATCTTGTGAAATGGGGAAGAACAAGCATTTGGATTGGACAAGCCGATCGATCATCTCGTCTGGAGGTGATAGAGTTCCTCTAATCAGAAAAGAGGTCAAGAGAAATGATAATGAAATCGGGTCGTCAAATGGCCCAGCAACGGACCTTGAGTATGGGGACGCAGTACAGGCAGCAAATGTTGGATTTTCCAGGGTTCTACTTTTGGCAAAGCCTGATGCAGGGAGGCTCGTTATCGCGACAATTGCTTTATTGAT...

Protein

Download Protein FASTA

650 aa · LXL04_006505|LXL04_006505|OH1004|PROTEIN

MKSCEMGKNKHLDWTSRSIISSGGDRVPLIRKEVKRNDNEIGSSNGPATDLEYGDAVQAANVGFSRVLLLAKPDAGRLVIATIALLIASTSSLLIPSFGGRIIDIVSRDIKTPEEQTEALNAVKDTILAVVLVVVVGSLSTALRAWLFSSASERVVARLRKDLFSHLMQQEIAFYDVTRTGELLSRLSEDTQIIKNAATTNLSEALRNLTTAFIGLCFMFSSSWKLTLLALVVVPIISVAVRYFGRYLRELSHATQAAAA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006505`
TK1151 ID	TkA03G043450
OH-1004 ID	LXL04_006505
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	94.000
Protein coverage (%)	TK1151 98.698 / OH-1004 99.846 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006505

Location Chr02:12416234-12421101 (-)

Description Similar to ABCB25: ABC transporter B family member 25

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g39040`	Probably involved in redistribution of internalized aluminum.	Arabidopsis ALS1 encodes a root tip and stele localized half type ABC transporter required for root growth in an aluminum toxic environment.2007 · DOI: 10.1007/s00425-006-0452-4

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0755100`	Metal transporter involved in the sequestration of aluminum into vacuoles, which is required for cellular detoxification of aluminum.	A tonoplast-localized half-size ABC transporter is required for internal detoxification of aluminum in rice.2012 · DOI: 10.1111/j.1365-313x.2011.04837.x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006505 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006783 heme biosynthetic process Biological Process

GO:0006839 mitochondrial transport Biological Process

GO:0006935 chemotaxis Biological Process

GO:0006972 hyperosmotic response Biological Process

GO:0010044 response to aluminum ion Biological Process

GO:0034514 mitochondrial unfolded protein response Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0070455 positive regulation of heme biosynthetic process Biological Process

GO:0090374 oligopeptide export from mitochondrion Biological Process

GO:0140982 detoxification of aluminum ion Biological Process

GO:0170037 export from the mitochondrion Biological Process

GO:1902602 aluminum ion transmembrane transport Biological Process

KEGG gene cross-reference

ath:AT5G39040

ddi:DDB_G0293416

dosa:Os03g0755100

hsa:23456

mmu:56199

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.316

Rank 1 · LXL04_006505 · OH-1004

Endoplasmic reticulum0.165

Rank 2 · LXL04_006505 · OH-1004

Cell membrane0.150

Rank 3 · LXL04_006505 · OH-1004

Cytoplasm0.125

Rank 4 · LXL04_006505 · OH-1004

Golgi apparatus0.103

Rank 5 · LXL04_006505 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00664.29ABC_membrane78-353 aa

PF00005.34ABC_tran421-571 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006505	`PF00664.29`	ABC_membrane	78	353	2.4e-61	208.5
LXL04_006505	`PF00005.34`	ABC_tran	421	571	7.4e-33	114.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WML0`	Arabidopsis thaliana	ABC transporter B family member 27	77.031%	Swiss-Prot	strong database homology
`Q9FNU2`	Oryza sativa subsp. japonica	ABC transporter B family member 25	75.235%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card