LXL04_005051 | RubberDandelionOmics

Gene overview

LXL04_005051

Reference: OH-1004 Chr: Chr01 Coordinates: 153835019-153837624 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1597 bp · LXL04_005051|LXL04_005051|OH1004|cDNA

ATGGGAAATTGCTGTGTTACCGGTGATGCCGCTCGTagaaaggagaagaagaagaggaggagggGAAATCACAAACCGAATCCTTTCTCAGTCGACTACCACAACCCATCTGCATCTCAAAACAATGAAAACGTTTTCTTCGTATTACGAGATCCCACAGGTCACGACATTTCACAGCGCTACAATCTAGGTCGAGAGCTGGGAAGAGGCGAATTCGGGGTAACATATCTGTGTACGGATTTAGGTACCGGTGAACGATT...

CDS

Download CDS FASTA

1593 bp · LXL04_005051|LXL04_005051|OH1004|CDS

ATGGGAAATTGCTGTGTTACCGGTGATGCCGCTCGTAGAAAGGAGAAGAAGAAGAGGAGGAGGGGAAATCACAAACCGAATCCTTTCTCAGTCGACTACCACAACCCATCTGCATCTCAAAACAATGAAAACGTTTTCTTCGTATTACGAGATCCCACAGGTCACGACATTTCACAGCGCTACAATCTAGGTCGAGAGCTGGGAAGAGGCGAATTCGGGGTAACATATCTGTGTACGGATTTAGGTACCGGTGAACGATT...

Protein

Download Protein FASTA

530 aa · LXL04_005051|LXL04_005051|OH1004|PROTEIN

MGNCCVTGDAARRKEKKKRRRGNHKPNPFSVDYHNPSASQNNENVFFVLRDPTGHDISQRYNLGRELGRGEFGVTYLCTDLGTGERLACKCISKRKLRTTVDIEDVRREVEIMKHLPKHPNIVTMRDTYEDNDAVHIVMELCEGGELFDRIVARGRYTERAAASIMRKIVEIVQMCHSHGVMHRDLKPENFLFGNKKESAPLKAIDFGLSVFFKPGEVFNEIVGSPYYMAPEVLKRNYGPEVDVWSSGVILYILLCGVPP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005051`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005051

Location Chr01:153835019-153837624 (-)

Description Similar to CPK7: Calcium-dependent protein kinase 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g12480`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At5g19450`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At3g57530`	May play a role in signal transduction pathways that involve calcium as a second messenger.	Arabidopsis calcium-dependent protein kinase AtCPK32 interacts with ABF4, a transcriptional regulator of abscisic acid-responsive gene expression, and modulates its activity.2005 · DOI: 10.1104/pp.105.069757
`At2g41860`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0568600`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005051 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009651 response to salt stress Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009536 plastid Cellular Component

GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function

GO:0004698 calcium,diacylglycerol-dependent serine/threonine kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G41860

ath:AT3G57530

ath:AT5G12480

ath:AT5G19450

dosa:Os07g0568600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.543

Rank 1 · LXL04_005051 · OH-1004

Cytoplasm0.371

Rank 2 · LXL04_005051 · OH-1004

Nucleus0.257

Rank 3 · LXL04_005051 · OH-1004

Golgi apparatus0.050

Rank 4 · LXL04_005051 · OH-1004

Endoplasmic reticulum0.047

Rank 5 · LXL04_005051 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase61-319 aa

PF07714.24PK_Tyr_Ser-Thr63-314 aa

PF14531.13Kinase-like154-307 aa

PF13499.13EF-hand_7367-426 aa

PF13833.13EF-hand_8379-429 aa

PF13499.13EF-hand_7437-500 aa

PF00036.39EF-hand_1439-463 aa

PF13405.13EF-hand_6439-464 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005051	`PF00069.32`	Pkinase	61	319	8.2e-80	268.7
LXL04_005051	`PF07714.24`	PK_Tyr_Ser-Thr	63	314	1e-25	91.2
LXL04_005051	`PF14531.13`	Kinase-like	154	307	7.6e-07	29.4
LXL04_005051	`PF13499.13`	EF-hand_7	367	426	4.4e-30	104.6
LXL04_005051	`PF13833.13`	EF-hand_8	379	429	3.6e-11	43.3
LXL04_005051	`PF13499.13`	EF-hand_7	437	500	4.4e-30	104.6
LXL04_005051	`PF00036.39`	EF-hand_1	439	463	1.7e-25	87.3
LXL04_005051	`PF13405.13`	EF-hand_6	439	464	1.2e-22	78.1
LXL04_005051	`PF13202.13`	EF-hand_5	441	461	2.8e-15	55.7
LXL04_005051	`PF13833.13`	EF-hand_8	450	500	3.6e-11	43.3
LXL04_005051	`PF00036.39`	EF-hand_1	475	501	1.7e-25	87.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q38873`	Arabidopsis thaliana	Calcium-dependent protein kinase 7	73.734%	Swiss-Prot	strong database homology
`Q42438`	Arabidopsis thaliana	Calcium-dependent protein kinase 8	73.396%	Swiss-Prot	strong database homology
`Q6NLQ6`	Arabidopsis thaliana	Calcium-dependent protein kinase 32	71.429%	Swiss-Prot	strong database homology
`P93759`	Arabidopsis thaliana	Calcium-dependent protein kinase 14	68.431%	Swiss-Prot	strong database homology
`Q84SL0`	Oryza sativa subsp. japonica	Calcium-dependent protein kinase 20	71.193%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card