LXL04_001106 | RubberDandelionOmics

Gene overview

LXL04_001106

Reference: OH-1004 Chr: Chr01 Coordinates: 20387155-20388549 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1236 bp · LXL04_001106|LXL04_001106|OH1004|cDNA

ATGTTTATCAGAATCCGAAGCAGAGACGGATTAGAGCGTCTGCAGGTCGATAACCCAAACATAACGATCGCACAGCTCAGAACCCTAATCGAATCGCAACTCAGAGTTCCAGTACACAACCAAACCTTATCAACAAACCAATCATTACTCTTAGCCAAAACCCAGACGGAGATGTCAGGATTCTCCGACATGTCTAACGCTCAAACCCTAATCTCTACTCTAGGTATCGCACACGGTTCGATCATCTACCTGGCTTACGA...

CDS

Download CDS FASTA

1236 bp · LXL04_001106|LXL04_001106|OH1004|CDS

ATGTTTATCAGAATCCGAAGCAGAGACGGATTAGAGCGTCTGCAGGTCGATAACCCAAACATAACGATCGCACAGCTCAGAACCCTAATCGAATCGCAACTCAGAGTTCCAGTACACAACCAAACCTTATCAACAAACCAATCATTACTCTTAGCCAAAACCCAGACGGAGATGTCAGGATTCTCCGACATGTCTAACGCTCAAACCCTAATCTCTACTCTAGGTATCGCACACGGTTCGATCATCTACCTGGCTTACGA...

Protein

Download Protein FASTA

411 aa · LXL04_001106|LXL04_001106|OH1004|PROTEIN

MFIRIRSRDGLERLQVDNPNITIAQLRTLIESQLRVPVHNQTLSTNQSLLLAKTQTEMSGFSDMSNAQTLISTLGIAHGSIIYLAYEGERTIAGPKIAPAGSFGRKMTMDDLIAKQMRITRQENPHCELVSFDRDAANGFQHYVNETLAFAVKRGGFMYGTVSEEGKVEVDFIYEPPQQGTEDNLILLRDPEEERLVEAIALGLGMRKVGFIFTQTIGQTKKDYTLSNREILQAVELQGESDLKEWVTVMVKLEVNDDGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001106`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001106

Location Chr01:20387155-20388549 (-)

Description Similar to At3g63000: NPL4-like protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g63000`	May be part of a complex that binds ubiquitinated proteins and that is necessary for the export of misfolded proteins from the ER to the cytoplasm, where they are degraded by the proteasome (By similarity).	No verified direct reference in this release
`At2g47970`	May be part of a complex that binds ubiquitinated proteins and that is necessary for the export of misfolded proteins from the ER to the cytoplasm, where they are degraded by the proteasome (By similarity).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0377700`	May be part of a complex that binds ubiquitinated proteins and that is necessary for the export of misfolded proteins from the ER to the cytoplasm, where they are degraded by the proteasome.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001106 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0007030 Golgi organization Biological Process

GO:0010498 proteasomal protein catabolic process Biological Process

GO:0030970 retrograde protein transport, ER to cytosol Biological Process

GO:0032480 negative regulation of type I interferon production Biological Process

GO:0034614 cellular response to reactive oxygen species Biological Process

GO:0036503 ERAD pathway Biological Process

GO:0039536 negative regulation of RIG-I signaling pathway Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0072344 rescue of stalled cytosolic ribosome Biological Process

GO:1902882 regulation of response to oxidative stress Biological Process

GO:1990116 ribosome-associated ubiquitin-dependent protein catabolic process Biological Process

KEGG gene cross-reference

ath:AT2G47970

ath:AT3G63000

ddi:DDB_G0290227

dosa:Os01g0377700

hsa:55666

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.603

Rank 1 · LXL04_001106 · OH-1004

Nucleus0.584

Rank 2 · LXL04_001106 · OH-1004

Endoplasmic reticulum0.062

Rank 3 · LXL04_001106 · OH-1004

Cell membrane0.061

Rank 4 · LXL04_001106 · OH-1004

Lysosome / Vacuole0.056

Rank 5 · LXL04_001106 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11543.16UN_NPL41-84 aa

PF05021.21NPL4156-283 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001106	`PF11543.16`	UN_NPL4	1	84	6.2e-07	30.6
LXL04_001106	`PF05021.21`	NPL4	156	283	6.1e-16	59.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LYC2`	Arabidopsis thaliana	NPL4-like protein B	69.512%	Swiss-Prot	strong database homology
`O82264`	Arabidopsis thaliana	NPL4-like protein A	69.417%	Swiss-Prot	strong database homology
`Q9AS33`	Oryza sativa subsp. japonica	NPL4-like protein	57.995%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card