TkAUNG005740 | RubberDandelionOmics

Gene overview

TkAUNG005740

Reference: TK1151 Chr: ChrUn Coordinates: 1631717-1632118 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

402 bp · TkAUNG005740|TK1151|cDNA

ATGGCGATACATTTATACAAAACTTCTACCCCGAGCACACGCAATGGAACCGTAGACCGTCAAGTGAAATACAATCCACGAAATAATTTGATCTATGGACAGCATCATTGTGGTAAAGGTCGTAATGCCAGAGGAATCATTACCGCAAGGCATAGAGGGGGAGGTCATAAGCGTCTATACCGTAAAATCGATTTTCAACGGAATGAAAAAGACATATATGGTAGAATCGTAACCATAGAATACGACCCTAATCGAAATGC...

CDS

Download CDS FASTA

402 bp · TkAUNG005740|TK1151|CDS

ATGGCGATACATTTATACAAAACTTCTACCCCGAGCACACGCAATGGAACCGTAGACCGTCAAGTGAAATACAATCCACGAAATAATTTGATCTATGGACAGCATCATTGTGGTAAAGGTCGTAATGCCAGAGGAATCATTACCGCAAGGCATAGAGGGGGAGGTCATAAGCGTCTATACCGTAAAATCGATTTTCAACGGAATGAAAAAGACATATATGGTAGAATCGTAACCATAGAATACGACCCTAATCGAAATGC...

Protein

Download Protein FASTA

133 aa · TkAUNG005740|TK1151|PROTEIN

MAIHLYKTSTPSTRNGTVDRQVKYNPRNNLIYGQHHCGKGRNARGIITARHRGGGHKRLYRKIDFQRNEKDIYGRIVTIEYDPNRNAYICLIHYGDGEKRYILHPRGAIIGDTIVSGTEVPIKMGNALPLSAV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG005740`
TK1151 ID	TkAUNG005740
OH-1004 ID	LXL04_004894
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	49.100
Protein coverage (%)	TK1151 42.857 / OH-1004 16.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG005740`
Location	ChrUn:1631717-1632118 (+)
Description	Similar to RPL2: 60S ribosomal protein L2, mitochondrial
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_004894` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006412 translation Biological Process GO:0032543 mitochondrial translation Biological Process GO:0005739 mitochondrion Cellular Component GO:0005762 mitochondrial large ribosomal subunit Cellular Component GO:0015934 large ribosomal subunit Cellular Component GO:0003723 RNA binding Molecular Function GO:0003729 mRNA binding Molecular Function GO:0003735 structural constituent of ribosome Molecular Function GO:0016740 transferase activity Molecular Function
KEGG gene cross-reference	dosa:rpl2 osa:6450181 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.687

Rank 1 · TkAUNG005740 · TK1151

Nucleus0.244

Rank 2 · TkAUNG005740 · TK1151

Mitochondrion0.057

Rank 3 · TkAUNG005740 · TK1151

Endoplasmic reticulum0.025

Rank 4 · TkAUNG005740 · TK1151

Plastid0.018

Rank 5 · TkAUNG005740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21378YceM-like_C19-58 aa

PF00181Ribosomal_L2_N28-116 aa

PF03714PUD63-99 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG005740	`PF21378`	YceM-like_C	19	58	0.3	12.1
TkAUNG005740	`PF00181`	Ribosomal_L2_N	28	116	3.8e-36	123.7
TkAUNG005740	`PF03714`	PUD	63	99	0.18	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card