LXL04_004894 | RubberDandelionOmics

Gene overview

LXL04_004894

Reference: OH-1004 Chr: Chr01 Coordinates: 149723616-149724740 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1053 bp · LXL04_004894|LXL04_004894|OH1004|cDNA

ATGGCATTTTCTTCGTATTGCCGTCAAGCTGTTAATGGATCCTTTTCTTTGATTACTTCGAGGATTAGCACCACCTCTCAGATGAGATCCAAGCACACTATCACCCGTGCTCAAAATGTCAGCTCAGAAAGGCCACTCAGGCAATTCCTTACAGGAAAAGACACGTCAGCAGGAAGAAACTCAAAAGGTCGCATCACAATTTTCCACAGAGGTGGAGGGGCAAAACGGTCACAAAGAACAATCGACCTAAAACGCAACAC...

CDS

Download CDS FASTA

1053 bp · LXL04_004894|LXL04_004894|OH1004|CDS

ATGGCATTTTCTTCGTATTGCCGTCAAGCTGTTAATGGATCCTTTTCTTTGATTACTTCGAGGATTAGCACCACCTCTCAGATGAGATCCAAGCACACTATCACCCGTGCTCAAAATGTCAGCTCAGAAAGGCCACTCAGGCAATTCCTTACAGGAAAAGACACGTCAGCAGGAAGAAACTCAAAAGGTCGCATCACAATTTTCCACAGAGGTGGAGGGGCAAAACGGTCACAAAGAACAATCGACCTAAAACGCAACAC...

Protein

Download Protein FASTA

350 aa · LXL04_004894|LXL04_004894|OH1004|PROTEIN

MAFSSYCRQAVNGSFSLITSRISTTSQMRSKHTITRAQNVSSERPLRQFLTGKDTSAGRNSKGRITIFHRGGGAKRSQRTIDLKRNTSSVGVVERIEYDPNRTSRIAVVRWVDVSPVDQPKKVNPTFTFTSPPKSLPSISIKGQFSFSSIPGIIQDTKVEPSRSKSDHVVVGLPKGQLTSQSQSQTGGQFTNVKDVFLSAFSYSNVKRHHSPYSFVNSLGVPRIAVAGAKPEFFVPRVKDDLRESESLMSNEVKRWDKES...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004894`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004894

Location Chr01:149723616-149724740 (+)

Description Similar to RPL2: 60S ribosomal protein L2, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`AtMg00560`	Large ribosomal subunit protein uL2mz, N-terminal part.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: P92812`	Large ribosomal subunit protein uL2m.	No verified direct reference in this release
`UniProt: Q2F969`	Large ribosomal subunit protein uL2m.	No verified direct reference in this release
`UniProt: P0C8K6`	Large ribosomal subunit protein uL2m.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004894 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006412 translation Biological Process

GO:0032543 mitochondrial translation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005762 mitochondrial large ribosomal subunit Cellular Component

GO:0015934 large ribosomal subunit Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0003735 structural constituent of ribosome Molecular Function

GO:0016740 transferase activity Molecular Function

KEGG gene cross-reference

dosa:rpl2

osa:6450181

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.772

Rank 1 · LXL04_004894 · OH-1004

Nucleus0.070

Rank 2 · LXL04_004894 · OH-1004

Cytoplasm0.057

Rank 3 · LXL04_004894 · OH-1004

Plastid0.041

Rank 4 · LXL04_004894 · OH-1004

Cell membrane0.005

Rank 5 · LXL04_004894 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00181.31Ribosomal_L2_N48-112 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004894	`PF00181.31`	Ribosomal_L2_N	48	112	2.8e-21	76.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93311`	Arabidopsis thaliana	Large ribosomal subunit protein uL2mz, N-terminal part	44.311%	Swiss-Prot	moderate database homology
`P92812`	Oryza sativa subsp. japonica	Large ribosomal subunit protein uL2m	57.732%	Swiss-Prot	weak database homology
`Q2F969`	Oryza sativa subsp. indica	Large ribosomal subunit protein uL2m	57.732%	Swiss-Prot	weak database homology
`P0C8K6`	Oryza sativa	Large ribosomal subunit protein uL2m	57.732%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card