TkA08G212010 | RubberDandelionOmics

Gene overview

TkA08G212010

Reference: TK1151 Chr: Chr08 Coordinates: 55482230-55484012 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1138 bp · TkA08G212010|TK1151|cDNA

GAAAATTTGAGTATATACACAATTTACCCAACCAAACGGCAACCTTTCGTTTATCTCCCCTATTTTTCCTTTTTGTCTCCCTCGTCAAATCATTCCTAATTTCAAACTCTGTAAACCCTAGCCAAAAATTACGCGCGCTCAGATCTTAAAACTATGGCGATCGCGAGGACCGGAGTTTTCGTTGACGACTACTTGGAGTATGCAAGCACATTGCCAGCTGAGCTGCAGAGGCTTCTCAACACCATAAGAGAGCTCGATGA...

CDS

Download CDS FASTA

771 bp · TkA08G212010|TK1151|CDS

ATGGCGATCGCGAGGACCGGAGTTTTCGTTGACGACTACTTGGAGTATGCAAGCACATTGCCAGCTGAGCTGCAGAGGCTTCTCAACACCATAAGAGAGCTCGATGAACGTTCTCAATCCATGATCAATCAAACAAGACAACAAACAAAGAACTGCTTGGATATCGCTTCTCAAAACTCCCACAAAGGCATACACGAAGATGGCGACATGGCTTTTGATAAAATGAAGAGAGCGATTGAAGAAAACCAAGATAATGCTTT...

Protein

Download Protein FASTA

256 aa · TkA08G212010|TK1151|PROTEIN

MAIARTGVFVDDYLEYASTLPAELQRLLNTIRELDERSQSMINQTRQQTKNCLDIASQNSHKGIHEDGDMAFDKMKRAIEENQDNALNLCTEKVLLARQAYDLIDSHVKRLDEDLHNFAEDLKQEGKLPADEPAILPPLPLVPKIEKRKLPYIVPQSKKLDYREREWDHRDRDFELMPPPGGFKRDYATPLEIDQPIDPNEPTYCVCHQVSFGDMIACDNENCQGGEWFHYSCVGLTPETRFKGKWYCPTCRQLPL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G212010`
TK1151 ID	TkA08G212010
OH-1004 ID	LXL04_032893
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G212010

Location Chr08:55482230-55484012 (+)

Description Similar to ING2: PHD finger protein ING2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g54390`	Histone-binding component that specifically recognizes H3 tails trimethylated on 'Lys-4' (H3K4me3), which mark transcription start sites of virtually all active genes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032893 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001558 regulation of cell growth Biological Process

GO:0006275 regulation of DNA replication Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006473 protein acetylation Biological Process

GO:0008285 negative regulation of cell population proliferation Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0045926 negative regulation of growth Biological Process

GO:0050793 regulation of developmental process Biological Process

GO:0051726 regulation of cell cycle Biological Process

GO:0140889 DNA replication-dependent chromatin disassembly Biological Process

KEGG gene cross-reference

ath:AT1G54390

gga:418281

hsa:51147

mmu:28019

mmu:66262

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.774

Rank 1 · TkA08G212010 · TK1151

Cytoplasm0.378

Rank 2 · TkA08G212010 · TK1151

Cell membrane0.033

Rank 3 · TkA08G212010 · TK1151

Mitochondrion0.027

Rank 4 · TkA08G212010 · TK1151

Endoplasmic reticulum0.020

Rank 5 · TkA08G212010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30669NUDT19_Nudix5-92 aa

PF12998ING9-118 aa

PF23729Spectrin_Dys-129-88 aa

PF10497zf-4CXXC_R144-54 aa

PF13771zf-HC5HC2H52-93 aa

PF23729Spectrin_Dys-1101-124 aa

PF13771zf-HC5HC2H197-234 aa

PF00628PHD205-251 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G212010	`PF30669`	NUDT19_Nudix	5	92	0.23	11.6
TkA08G212010	`PF12998`	ING	9	118	2.2e-18	67.4
TkA08G212010	`PF23729`	Spectrin_Dys-1	29	88	0.52	11.1
TkA08G212010	`PF10497`	zf-4CXXC_R1	44	54	6.4	7.7
TkA08G212010	`PF13771`	zf-HC5HC2H	52	93	0.031	15.2
TkA08G212010	`PF23729`	Spectrin_Dys-1	101	124	0.52	11.1
TkA08G212010	`PF13771`	zf-HC5HC2H	197	234	0.031	15.2
TkA08G212010	`PF00628`	PHD	205	251	1.3e-05	25.8
TkA08G212010	`PF27108`	PHD_Pygo	206	240	0.075	13.8
TkA08G212010	`PF10497`	zf-4CXXC_R1	206	253	6.4	7.7
TkA08G212010	`PF22908`	PHD_NSD	207	249	0.85	10.7
TkA08G212010	`PF23011`	PHD-1st_NSD	211	252	0.045	14.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B3H615`	Arabidopsis thaliana	sp\|B3H615\|ING2_ARATH PHD finger protein ING2	77.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card