TkA08G138270 | RubberDandelionOmics

Gene overview

TkA08G138270

Reference: TK1151 Chr: Chr08 Coordinates: 35969982-35972665 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1774 bp · TkA08G138270|TK1151|cDNA

CTGCACAACCAAGAATTTTAGCACCGCTAGCAATCTCATTGTCCGTCACCCCAATACCGTACATTTTGGATTTATGAAAGTTAACCTTGAGACCCGAGGCAGCATGAAAACATCTCAAGATTCTAGCAAGGTTATGGAAATTAGAGCTCGACCAATCTCCCACAAACATGGCATCATCCGCATAAAAGAGGTGGGAGATATCCGGACCGTTGTTAGGTGTGCTCACCCCTCGGAAAAGGGACTTCTCACAAGCCGTGAGC...

CDS

Download CDS FASTA

1107 bp · TkA08G138270|TK1151|CDS

ATGGAGATCGTCTGGCAAACTCCGGCCAACCCTCCGGAGCGCCATGATTATATCTTCCGTAACGGCATTCGTTATGTTAAACCCTACTACTTCGAATTCATTTCTCATGCTAAGGTTCGGTGGGCCGGGAAAACCATCGTGGATCTATTTGCTGACGAATTCAAAGGTCGAAACCGTGATTACTATGAATCTGCTGTTAAGTCTGGACGCATACAGGTAGATGGAAAAACAGTATCTATTTACTACAGAGTTCAATCATC...

Protein

Download Protein FASTA

368 aa · TkA08G138270|TK1151|PROTEIN

MEIVWQTPANPPERHDYIFRNGIRYVKPYYFEFISHAKVRWAGKTIVDLFADEFKGRNRDYYESAVKSGRIQVDGKTVSIYYRVQSSQKISHFLHRHEPPVMGLDVKILHKGEDVLTVCKPASVPVHPCGQYRKNTVVGILQAEHDLAPLFPIHRLDRLVSGLLILARSASQADIFRQQIESGMVQKQYIAKVVGEFPENEQVVNLRVNFNAKEGISTVEPESTLEKVNGKSACTKFIRIHTNGKYSIVSCHPITGRTHQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G138270`
TK1151 ID	TkA08G138270
OH-1004 ID	LXL04_031959
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 98.133 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G138270

Location Chr08:35969982-35972665 (+)

Description Similar to Os02g0512300: RNA pseudouridine synthase 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51140`	RNA pseudouridine synthase 7.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0512300`	RNA pseudouridine synthase 7.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031959 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000455 enzyme-directed rRNA pseudouridine synthesis Biological Process

GO:0006397 mRNA processing Biological Process

GO:0031119 tRNA pseudouridine synthesis Biological Process

GO:1990481 mRNA pseudouridine synthesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0009982 pseudouridine synthase activity Molecular Function

GO:0160151 tRNA pseudouridine(32) synthase activity Molecular Function

KEGG gene cross-reference

ath:AT5G51140

hsa:27079

mmu:271842

spo:2542607

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.573

Rank 1 · TkA08G138270 · TK1151

Nucleus0.529

Rank 2 · TkA08G138270 · TK1151

Mitochondrion0.095

Rank 3 · TkA08G138270 · TK1151

Cell membrane0.024

Rank 4 · TkA08G138270 · TK1151

Peroxisome0.020

Rank 5 · TkA08G138270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01479S432-44 aa

PF01479S465-88 aa

PF15866DUF472984-126 aa

PF00849PseudoU_synth_2114-267 aa

PF01479S4155-175 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G138270	`PF01479`	S4	32	44	0.047	14.2
TkA08G138270	`PF01479`	S4	65	88	0.047	14.2
TkA08G138270	`PF15866`	DUF4729	84	126	0.14	12.3
TkA08G138270	`PF00849`	PseudoU_synth_2	114	267	6.1e-30	105.2
TkA08G138270	`PF01479`	S4	155	175	0.047	14.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LU60`	Arabidopsis thaliana	sp\|Q9LU60\|PUS7_ARATH RNA pseudouridine synthase 7	64.300%	Swiss-Prot	High
`Q0E0Y3`	Oryza sativa subsp. japonica	sp\|Q0E0Y3\|PUS7_ORYSJ RNA pseudouridine synthase 7	64.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card