TkA07G410810 | RubberDandelionOmics

Gene overview

TkA07G410810

Reference: TK1151 Chr: Chr07 Coordinates: 103746447-103748504 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1615 bp · TkA07G410810|TK1151|cDNA

TATAAAATAAATAATTATGTGTTATAATTATGATTAGTGATTAACCCCACAAATAAACACACCTCATTACTATAATTTAATTTCACCTACAAAAGTTGATCAATCGGCATGGTTGTGTGAATTTTAGTCGATCTACAATCAGCTCCAAATCTCCCATGATCTGTAATTACGTCGACAGACGGAAACTAACGAACCTTTTGATCTCGATCAGTAGACGTGGTAAGATTCAATCTTTTCTGAGAGCATAACAGAAAAAAGGG...

CDS

Download CDS FASTA

1056 bp · TkA07G410810|TK1151|CDS

ATGGGGTGTTCTTTTTCGGGATTAAACGCCCTATACGACGCTGTTAACGGAGGCGCCGATGTTTGGATCAACGACAACCGCTTCAAAATCGTCCGTCAGCTCGGCGAGGGTGGTTTTGCCTATGTATTCCTTGTTAGGGAGGCCATCACCGATGATTCCGCCGGTGGCGTCTCGAAGAAATTCAAAGACCCCTCACACATCTCCGACGATGGAACTTATGCGATGAAGAAAGTTCTGATTCAGAATAGCGATCAGCTGGA...

Protein

Download Protein FASTA

351 aa · TkA07G410810|TK1151|PROTEIN

MGCSFSGLNALYDAVNGGADVWINDNRFKIVRQLGEGGFAYVFLVREAITDDSAGGVSKKFKDPSHISDDGTYAMKKVLIQNSDQLELVKEEIRVSALFSHPNLLPLLDHAIIPVKRSCSVLQSTSEQPWTHEAYLLFPVHLDGTLLDNATTMKSKKLFYSTSDVLHIFRQLCAGLKHLHTLTPPFAHNDVKPGNVLLTHRKGQPPLAILMDFGSARPARRQIRSRSEALQLQEWASEHVSAPFRAPELWDCPSQTDIDE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G410810`
TK1151 ID	TkA07G410810
OH-1004 ID	LXL04_030551
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G410810`
Location	Chr07:103746447-103748504 (-)
Description	Similar to Stk16: Serine/threonine-protein kinase 16
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030551` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006468 protein phosphorylation Biological Process GO:0006624 vacuolar protein processing Biological Process GO:0023052 signaling Biological Process GO:0032889 regulation of vacuole fusion, non-autophagic Biological Process GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process GO:0046777 protein autophosphorylation Biological Process GO:0071560 cellular response to transforming growth factor beta stimulus Biological Process GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005773 vacuole Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005794 Golgi apparatus Cellular Component
KEGG gene cross-reference	ddi:DDB_G0280111 hsa:8576 mmu:20872 rno:286927 spo:2543440 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.657

Rank 1 · TkA07G410810 · TK1151

Nucleus0.385

Rank 2 · TkA07G410810 · TK1151

Golgi apparatus0.073

Rank 3 · TkA07G410810 · TK1151

Endoplasmic reticulum0.071

Rank 4 · TkA07G410810 · TK1151

Cell membrane0.069

Rank 5 · TkA07G410810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714PK_Tyr_Ser-Thr30-283 aa

PF00069Pkinase66-341 aa

PF03109ABC1143-225 aa

PF01636APH182-218 aa

PF01636APH216-251 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G410810	`PF07714`	PK_Tyr_Ser-Thr	30	283	2.1e-11	44.3
TkA07G410810	`PF00069`	Pkinase	66	341	5.8e-29	102.0
TkA07G410810	`PF03109`	ABC1	143	225	0.024	14.5
TkA07G410810	`PF01636`	APH	182	218	0.14	12.6
TkA07G410810	`PF01636`	APH	216	251	0.14	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card