TkA07G394770 | RubberDandelionOmics

Gene overview

TkA07G394770

Reference: TK1151 Chr: Chr07 Coordinates: 99162615-99165653 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1676 bp · TkA07G394770|TK1151|cDNA

ATTTATTTGGGTGTGCTTCGACTACTCCGAAGAAGAAACCCAGCGTACACCGTCAGCTCAACCAGAAATCCCAAACACCACCTTCGTGCATGTTCATCTCTTCTTCGATTCCATGACCTCTATATTCCCATCCAACATTCTCATTGATTCATCAACATCAGTAATCACCTCAAAAAACTAAACAATTTCCTGTTTTCTTCTCGTATACATTCCATTACAGTCACAGATTCTGTTTATTTGCTGTGTAATGGCAAATGCAT...

CDS

Download CDS FASTA

1200 bp · TkA07G394770|TK1151|CDS

ATGGCAAATGCATCCTGGGTTTTCACTCCTACACTTCCTCATCTTAATCGAAAGAGGATTTCCTCATCCGTAGCCATTTTTCGATCTGGATTGTATTCCCCTGATGCAATCTCTAAAAGGATATCATGCGCCAGTACCGCTCGAGGTGCCGATAAGCTCTCTAGTAATGAATCTCGTCCCGCTAGGCTAGTTGGCAAGGGTTGCAAATTAGTTGGATGTGGTTCAGCTGTACCTACTCTTCAAATTTCAAACGACGATCT...

Protein

Download Protein FASTA

399 aa · TkA07G394770|TK1151|PROTEIN

MANASWVFTPTLPHLNRKRISSSVAIFRSGLYSPDAISKRISCASTARGADKLSSNESRPARLVGKGCKLVGCGSAVPTLQISNDDLSKIVDTNDEWISVRTGIRNRRVLSGKDRMTDLATEAAKKALEMANVHPDDVDLVLLCTSTADDLFGSAPQIQAALGCKGNPLAFDITAACSGFLLGLISASCYIRGGGFKNVLVIGADALSRFVDWTDRGTCILFGDAAGAVLIQACESEEDGIFGFDVHSDGEGNRHLNAGV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G394770`
TK1151 ID	TkA07G394770
OH-1004 ID	LXL04_030288
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G394770

Location Chr07:99162615-99165653 (+)

Description Similar to KAS3B: 3-oxoacyl-[acyl-carrier-protein] synthase 3 B, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g62640`	Catalyzes the condensation reaction of fatty acid synthesis by the addition to an acyl acceptor of two carbons from malonyl-ACP.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030288 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0030497 fatty acid elongation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004315 3-oxoacyl-[acyl-carrier-protein] synthase activity Molecular Function

GO:0033818 beta-ketoacyl-acyl-carrier-protein synthase III activity Molecular Function

KEGG gene cross-reference

ath:AT1G62640

mar:MAE_19470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.962

Rank 1 · TkA07G394770 · TK1151

Mitochondrion0.064

Rank 2 · TkA07G394770 · TK1151

Cytoplasm0.039

Rank 3 · TkA07G394770 · TK1151

Peroxisome0.033

Rank 4 · TkA07G394770 · TK1151

Nucleus0.022

Rank 5 · TkA07G394770 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08545ACP_syn_III69-99 aa

PF00108Thiolase_N100-209 aa

PF22691Thiolase_C_1108-144 aa

PF07451SpoVAD118-202 aa

PF02801Ketoacyl-synt_C120-141 aa

PF08541ACP_syn_III_C128-143 aa

PF08545ACP_syn_III171-250 aa

PF07451SpoVAD271-334 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G394770	`PF08545`	ACP_syn_III	69	99	2.5e-31	108.1
TkA07G394770	`PF00108`	Thiolase_N	100	209	1.8e-05	25.0
TkA07G394770	`PF22691`	Thiolase_C_1	108	144	1.6e-05	25.4
TkA07G394770	`PF07451`	SpoVAD	118	202	0.002	17.6
TkA07G394770	`PF02801`	Ketoacyl-synt_C	120	141	0.21	12.3
TkA07G394770	`PF08541`	ACP_syn_III_C	128	143	1.3e-38	131.8
TkA07G394770	`PF08545`	ACP_syn_III	171	250	2.5e-31	108.1
TkA07G394770	`PF07451`	SpoVAD	271	334	0.002	17.6
TkA07G394770	`PF22691`	Thiolase_C_1	298	326	1.6e-05	25.4
TkA07G394770	`PF02797`	Chal_sti_synt_C	303	392	0.0005	20.8
TkA07G394770	`PF02801`	Ketoacyl-synt_C	303	325	0.21	12.3
TkA07G394770	`PF08541`	ACP_syn_III_C	309	398	1.3e-38	131.8
TkA07G394770	`PF22691`	Thiolase_C_1	368	392	1.6e-05	25.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P49243`	Arabidopsis thaliana	sp\|P49243\|FABH_ARATH Beta-ketoacyl-[acyl-carrier-protein] synthase III, chloroplastic	71.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card