TkA07G110860 | RubberDandelionOmics

Gene overview

TkA07G110860

Reference: TK1151 Chr: Chr07 Coordinates: 28717963-28718700 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

681 bp · TkA07G110860|TK1151|cDNA

ATGGAGAATCGCTCAAAATTACAAATCTCCAAAGCCTTTCAAGCCGCCTTCAGTTCTTGCCGGCCGAAAACCAACTCCGACGTCTCCGATCGCCAAGTATCCTTCGTGAAAACCTCCCATCACCGCCGCCTCATCGATCTTTTCTCACCAAAACCTCAACCACTTTCTTCAACGTACTGTAATCCCAAACCCCATCTTTCCCGGCTCGGAACCACACCTTATCCGGCGAACACAGACCGGCAGACACCGCATTCCATTTC...

CDS

Download CDS FASTA

681 bp · TkA07G110860|TK1151|CDS

ATGGAGAATCGCTCAAAATTACAAATCTCCAAAGCCTTTCAAGCCGCCTTCAGTTCTTGCCGGCCGAAAACCAACTCCGACGTCTCCGATCGCCAAGTATCCTTCGTGAAAACCTCCCATCACCGCCGCCTCATCGATCTTTTCTCACCAAAACCTCAACCACTTTCTTCAACGTACTGTAATCCCAAACCCCATCTTTCCCGGCTCGGAACCACACCTTATCCGGCGAACACAGACCGGCAGACACCGCATTCCATTTC...

Protein

Download Protein FASTA

226 aa · TkA07G110860|TK1151|PROTEIN

MENRSKLQISKAFQAAFSSCRPKTNSDVSDRQVSFVKTSHHRRLIDLFSPKPQPLSSTYCNPKPHLSRLGTTPYPANTDRQTPHSISPVHEKSSKRGRKKPHYRKRRNTASFSSLTDNYYNNWWSSDESDGKNTLFSRQSFSSESLESVPVDGVAVAKESSDPHEDFRVSMVDMIVEKGIFRFEELENLVECFLSLNSEEHHKVIFEVFAEIWETLVSKSDLYNKE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G110860`
TK1151 ID	TkA07G110860
OH-1004 ID	LXL04_027983
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	91.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G110860

Location Chr07:28717963-28718700 (-)

Description Similar to OFP8: Transcription repressor OFP8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g19650`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	Arabidopsis ovate family proteins, a novel transcriptional repressor family, control multiple aspects of plant growth and development.2011 · DOI: 10.1371/journal.pone.0023896
`At2g18500`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	No verified direct reference in this release
`At3g52525`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	No verified direct reference in this release
`At5g01840`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	A central role of Arabidopsis thaliana ovate family proteins in networking and subcellular localization of 3-aa loop extension homeodomain proteins.2005 · DOI: 10.1073/pnas.0501181102 Arabidopsis Ovate Family Protein 1 is a transcriptional repressor that suppresses cell elongation.2007 · DOI: 10.1111/j.1365-313x.2007.03096.x OVATE FAMILY PROTEIN4 (OFP4) interaction with KNAT7 regulates secondary cell wall formation in Arabidopsis thaliana.2011 · DOI: 10.1111/j.1365-313x.2011.04595.x Arabidopsis ovate family proteins, a novel transcriptional repressor family, control multiple aspects of plant growth and development.2011 · DOI: 10.1371/journal.pone.0023896

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0864000`	Probable transcriptional repressor that regulates multiple aspects of plant growth and development, partly through brassinosteroid (BR) signaling pathway.	OVATE Family Protein 8 Positively Mediates Brassinosteroid Signaling through Interacting with the GSK3-like Kinase in Rice.2016 · DOI: 10.1371/journal.pgen.1006118

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027983 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:1900457 regulation of brassinosteroid mediated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G18500

ath:AT3G52525

ath:AT5G19650

ath:AT5G58360

dosa:Os01g0864000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.437

Rank 1 · TkA07G110860 · TK1151

Nucleus0.391

Rank 2 · TkA07G110860 · TK1151

Cell membrane0.283

Rank 3 · TkA07G110860 · TK1151

Endoplasmic reticulum0.077

Rank 4 · TkA07G110860 · TK1151

Plastid0.044

Rank 5 · TkA07G110860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04844Ovate160-216 aa

PF12899Glyco_hydro_100181-219 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G110860	`PF04844`	Ovate	160	216	5e-24	84.8
TkA07G110860	`PF12899`	Glyco_hydro_100	181	219	0.25	10.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3E9B4`	Arabidopsis thaliana	sp\|Q3E9B4\|OFP8_ARATH Transcription repressor OFP8	35.400%	Swiss-Prot	Medium
`Q9ZU65`	Arabidopsis thaliana	sp\|Q9ZU65\|OFP7_ARATH Transcription repressor OFP7	57.100%	Swiss-Prot	Low
`Q3EAL1`	Arabidopsis thaliana	sp\|Q3EAL1\|OFP6_ARATH Transcription repressor OFP6	49.400%	Swiss-Prot	Low
`Q9LZW2`	Arabidopsis thaliana	sp\|Q9LZW2\|OFP1_ARATH Transcription repressor OFP1	49.200%	Swiss-Prot	Low
`Q94CV1`	Oryza sativa subsp. japonica	sp\|Q94CV1\|OFP8_ORYSJ Transcription repressor OFP8	52.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card