TkA07G056710 | RubberDandelionOmics

Gene overview

TkA07G056710

Reference: TK1151 Chr: Chr07 Coordinates: 15096052-15096744 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

693 bp · TkA07G056710|TK1151|cDNA

ATGGAAACGTTGAAAGAACGTGAAAATCAACACAAAGTTCGCAAAAAACGGATGAACTCTGAAGAAATCGATGAGGAAAGGGGAGAAGATCGAATCAGTACGTTGCAAGATTGCTTACTTCTCGAAATCCTCTCTCGTTTACCTTCCACAAAAGACGCCATCAGAACAGGTACTCTCTCCAAACGATGGCAGCATGTTTGGACTTCCGTCCCTATTCTCAGCTTCACGACTACAGACAATTATATCGCCAATCAAGGTCG...

CDS

Download CDS FASTA

693 bp · TkA07G056710|TK1151|CDS

ATGGAAACGTTGAAAGAACGTGAAAATCAACACAAAGTTCGCAAAAAACGGATGAACTCTGAAGAAATCGATGAGGAAAGGGGAGAAGATCGAATCAGTACGTTGCAAGATTGCTTACTTCTCGAAATCCTCTCTCGTTTACCTTCCACAAAAGACGCCATCAGAACAGGTACTCTCTCCAAACGATGGCAGCATGTTTGGACTTCCGTCCCTATTCTCAGCTTCACGACTACAGACAATTATATCGCCAATCAAGGTCG...

Protein

Download Protein FASTA

230 aa · TkA07G056710|TK1151|PROTEIN

METLKERENQHKVRKKRMNSEEIDEERGEDRISTLQDCLLLEILSRLPSTKDAIRTGTLSKRWQHVWTSVPILSFTTTDNYIANQGRQNPKTSSDFFSLVTKTLMQCPQLHLAKFKVDSGYDIEFESQVNSWIRYAVSRGVEELYLSFGAEPFVEALLDQSFFICSCFTNLCLQSCKLNPTGEITWKNLRSLCLKYGEFDDGLIENILSGSPVLERLCLGYGVVIIKRID

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G056710`
TK1151 ID	TkA07G056710
OH-1004 ID	LXL04_027357
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	54.800
Protein coverage (%)	TK1151 96.522 / OH-1004 21.756 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G056710

Location Chr07:15096052-15096744 (-)

Description Similar to At5g03100: F-box protein At5g03100

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g02920`	F-box/LRR-repeat protein 25.	No verified direct reference in this release
`At1g49610`	Putative F-box protein At1g49610.	No verified direct reference in this release
`At5g02930`	Putative F-box/LRR-repeat protein At5g02930.	No verified direct reference in this release
`At5g22660`	F-box/FBD/LRR-repeat protein At5g22660.	No verified direct reference in this release
`At5g22700`	F-box/FBD/LRR-repeat protein At5g22700.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027357 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

KEGG gene cross-reference

ath:AT3G28410

ath:AT5G02700

ath:AT5G03100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.847

Rank 1 · TkA07G056710 · TK1151

Cytoplasm0.205

Rank 2 · TkA07G056710 · TK1151

Cell membrane0.038

Rank 3 · TkA07G056710 · TK1151

Endoplasmic reticulum0.037

Rank 4 · TkA07G056710 · TK1151

Plastid0.019

Rank 5 · TkA07G056710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box32-73 aa

PF12937F-box-like39-66 aa

PF23622LRR_At1g61320_AtMIF1114-222 aa

PF24758LRR_At5g56370130-222 aa

PF00646F-box203-217 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G056710	`PF00646`	F-box	32	73	0.0004	20.9
TkA07G056710	`PF12937`	F-box-like	39	66	0.023	15.2
TkA07G056710	`PF23622`	LRR_At1g61320_AtMIF1	114	222	4.7e-09	36.8
TkA07G056710	`PF24758`	LRR_At5g56370	130	222	6.2e-11	43.1
TkA07G056710	`PF00646`	F-box	203	217	0.0004	20.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q1PE04`	Arabidopsis thaliana	sp\|Q1PE04\|FBL25_ARATH F-box/LRR-repeat protein 25	34.900%	Swiss-Prot	Medium
`Q9FX89`	Arabidopsis thaliana	sp\|Q9FX89\|FB50_ARATH Putative F-box protein At1g49610	35.600%	Swiss-Prot	Medium
`Q9LYZ2`	Arabidopsis thaliana	sp\|Q9LYZ2\|FBL80_ARATH Putative F-box/LRR-repeat protein At5g02930	34.700%	Swiss-Prot	Medium
`Q9FNJ5`	Arabidopsis thaliana	sp\|Q9FNJ5\|FDL31_ARATH F-box/FBD/LRR-repeat protein At5g22660	26.500%	Swiss-Prot	Low
`Q9FNJ1`	Arabidopsis thaliana	sp\|Q9FNJ1\|FDL47_ARATH F-box/FBD/LRR-repeat protein At5g22700	29.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card