TkA07G051030 | RubberDandelionOmics

Gene overview

TkA07G051030

Reference: TK1151 Chr: Chr07 Coordinates: 13548348-13554125 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3762 bp · TkA07G051030|TK1151|cDNA

GTCGAAGAGTGTTGGATGTTTGAATGCTATCGACATCCTTTTTTTTTTGTTTTGGAACCAACGGAATAAATAAACCACCGCCTAGAAAGAGAAATAAAGGAAATAAAAAAAATTATATCGTTATTATGTCATTATCTCATAAGATGCGGTAAAAAGATACCCGATATGAAAACGACGCCTAAAATGATGCGATAGACGAGACCTAAATAAGCCATAGTCGGAGGGCAAAAAGGTAACTTGAAACCAAGGACAATAAATGT...

CDS

Download CDS FASTA

873 bp · TkA07G051030|TK1151|CDS

ATGCCGTTGGTGAGGGTCGAGGTGAGAAATGAATACGGATTGGGAATGCCGGAGTTGTACACGGAAACCGATAGAGAAGATCCGAAGGCGGTGCTTGACGGCGTCGCCGTTGCTGGCCTCGTCGGAATCCTGCGTCAATTAGGCGATCTCGCCGAATTTGCAGCAGAAGTTTTTCATGGGTTACAAGAACAAGTGCTAATTACATCTTCTAGAAGCCATAAATTGGTGGAACGAGTATACAACATTGAAGCTGCACTACC...

Protein

Download Protein FASTA

290 aa · TkA07G051030|TK1151|PROTEIN

MPLVRVEVRNEYGLGMPELYTETDREDPKAVLDGVAVAGLVGILRQLGDLAEFAAEVFHGLQEQVLITSSRSHKLVERVYNIEAALPPLEKAILAQRSHLHFAYTAGSHWHTRLRTEQNHFIYSDLPRCIMDSYEDCRDPPRLHKLDKYDIGGPGSCFKRYSDPTYFKRTSSSSPYETHLQNVPKEKKARRYKKKKSSRYKNLTHEAPVTTHAGSMDFGFSNVVEKASPSPDISKFNVPQTSGIDPEIDHLTSFESRNGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G051030`
TK1151 ID	TkA07G051030
OH-1004 ID	LXL04_027339
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 98.621 / OH-1004 30.329 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G051030

Location Chr07:13548348-13554125 (-)

Description Similar to SCAR3: Protein SCAR3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g29170`	Involved in regulation of actin and microtubule organization.	No verified direct reference in this release
`At2g34150`	Involved in regulation of actin and microtubule organization.	No verified direct reference in this release
`At4g18600`	Scar-like domain-containing protein WAVE 5.	No verified direct reference in this release
`At2g38440`	Involved in regulation of actin and microtubule organization.	DISTORTED3/SCAR2 is a putative arabidopsis WAVE complex subunit that activates the Arp2/3 complex and is required for epidermal morphogenesis.2005 · DOI: 10.1105/tpc.104.027987 IRREGULAR TRICHOME BRANCH1 in Arabidopsis encodes a plant homolog of the actin-related protein2/3 complex activator Scar/WAVE that regulates actin and microtubule organization.2005 · DOI: 10.1105/tpc.104.028670

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0208600`	Involved in regulation of actin and microtubule organization.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027339 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0030036 actin cytoskeleton organization Biological Process

GO:0051127 positive regulation of actin nucleation Biological Process

GO:2000601 positive regulation of Arp2/3 complex-mediated actin nucleation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0031209 SCAR complex Cellular Component

GO:0071944 cell periphery Cellular Component

GO:0003779 actin binding Molecular Function

KEGG gene cross-reference

ath:AT1G29170

ath:AT2G34150

ath:AT4G18600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.402

Rank 1 · TkA07G051030 · TK1151

Cell membrane0.381

Rank 2 · TkA07G051030 · TK1151

Nucleus0.347

Rank 3 · TkA07G051030 · TK1151

Endoplasmic reticulum0.063

Rank 4 · TkA07G051030 · TK1151

Golgi apparatus0.045

Rank 5 · TkA07G051030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27569SCAR_helical3-191 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G051030	`PF27569`	SCAR_helical	3	191	3.6e-71	239.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LP46`	Arabidopsis thaliana	sp\|Q9LP46\|SCAR3_ARATH Protein SCAR3	53.200%	Swiss-Prot	High
`Q6AWX6`	Arabidopsis thaliana	sp\|Q6AWX6\|SCAR1_ARATH Protein SCAR1	67.200%	Swiss-Prot	Medium
`Q5XPK0`	Arabidopsis thaliana	sp\|Q5XPK0\|SCARL_ARATH Scar-like domain-containing protein WAVE 5	56.800%	Swiss-Prot	High
`Q5XPJ9`	Arabidopsis thaliana	sp\|Q5XPJ9\|SCAR2_ARATH Protein SCAR2	52.100%	Swiss-Prot	High
`Q5QNA6`	Oryza sativa subsp. japonica	sp\|Q5QNA6\|SCRL2_ORYSJ SCAR-like protein 2	55.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card