TkA06G194730 | RubberDandelionOmics

Gene overview

TkA06G194730

Reference: TK1151 Chr: Chr06 Coordinates: 50715367-50717530 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1479 bp · TkA06G194730|TK1151|cDNA

ATGGATGACCCCGAATCAGAGGCAAGTAAGATACATAGGGAGTATTACAAAGGAGAGACTGAAGATAATGAAGATATTGAGTCGGATGAAGAATCAAGTGAAGACGAGAAGGCTTTCGTTGTTGATGCAGAACTAGATGACTATGATGCTGAGGAAGGAAGCTGTGAACAGGGTAAGCTTCCATTTGATGCGTTCATGTACGATATCTGTAACCCCCCTGTTTACAATGACACTGAAAATCGGGATGGGGAAGCTATTAG...

CDS

Download CDS FASTA

1479 bp · TkA06G194730|TK1151|CDS

ATGGATGACCCCGAATCAGAGGCAAGTAAGATACATAGGGAGTATTACAAAGGAGAGACTGAAGATAATGAAGATATTGAGTCGGATGAAGAATCAAGTGAAGACGAGAAGGCTTTCGTTGTTGATGCAGAACTAGATGACTATGATGCTGAGGAAGGAAGCTGTGAACAGGGTAAGCTTCCATTTGATGCGTTCATGTACGATATCTGTAACCCCCCTGTTTACAATGACACTGAAAATCGGGATGGGGAAGCTATTAG...

Protein

Download Protein FASTA

492 aa · TkA06G194730|TK1151|PROTEIN

MDDPESEASKIHREYYKGETEDNEDIESDEESSEDEKAFVVDAELDDYDAEEGSCEQGKLPFDAFMYDICNPPVYNDTENRDGEAIREEGLSDKVKGLNETHTCVREYSHATLVNPNWIAKQFMKQLCQRPKMKAREMKEEIKKKFLCVVSKGQCYRAKKKAQELLTGKLTKKHLTWREDVCPAILKKLEEWCVDLRLWTVVASDTHVFEVRLGFDAYQVDVQQMFCTCRLWEISGIPCIYACAAMRFTNQQSQDLISSW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G194730`
TK1151 ID	TkA06G194730
OH-1004 ID	LXL04_026865
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	68.700
Protein coverage (%)	TK1151 79.268 / OH-1004 60.720 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G194730`
Location	Chr06:50715367-50717530 (-)
Description	Similar to At1g12160: Flavin-containing monooxygenase FMO GS-OX-like 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_026865` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009751 response to salicylic acid Biological Process GO:0009753 response to jasmonic acid Biological Process GO:0019761 glucosinolate biosynthetic process Biological Process GO:0033506 glucosinolate biosynthetic process from homomethionine Biological Process GO:0005634 nucleus Cellular Component GO:0004497 monooxygenase activity Molecular Function GO:0004499 N,N-dimethylaniline monooxygenase activity Molecular Function GO:0050660 flavin adenine dinucleotide binding Molecular Function GO:0050661 NADP binding Molecular Function GO:0080102 3-methylthiopropyl glucosinolate S-oxygenase activity Molecular Function GO:0080103 4-methylthiopropyl glucosinolate S-oxygenase activity Molecular Function GO:0080104 5-methylthiopropyl glucosinolate S-oxygenase activity Molecular Function
KEGG gene cross-reference	ath:AT1G12160 ath:AT1G62620 ath:AT1G63340 ath:AT1G63370 ath:AT1G65860 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.962

Rank 1 · TkA06G194730 · TK1151

Cytoplasm0.090

Rank 2 · TkA06G194730 · TK1151

Cell membrane0.019

Rank 3 · TkA06G194730 · TK1151

Mitochondrion0.013

Rank 4 · TkA06G194730 · TK1151

Endoplasmic reticulum0.012

Rank 5 · TkA06G194730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04434SWIM39-55 aa

PF08095Toxin_25155-157 aa

PF04434SWIM218-240 aa

PF08095Toxin_25331-345 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G194730	`PF04434`	SWIM	39	55	0.00028	21.1
TkA06G194730	`PF08095`	Toxin_25	155	157	3.0	9.0
TkA06G194730	`PF04434`	SWIM	218	240	0.00028	21.1
TkA06G194730	`PF08095`	Toxin_25	331	345	3.0	9.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card