Gene Card
Gene overview
cDNA / CDS / Protein Sequences
cDNA
No cDNA sequence is available for this reference.
1533 bp · TkA05G110530|TK1151|CDS
ATGAACAACCACACTGATGACACCTCAACCGACCCAACCACCCACCGGAAACACGCCGCCATGATCGACCGCCTATCGAACCTCCACCAGGCCCGCCTTTCCACCAAACCCAACCCTAAAGACCCGACCTTCGAGTCCACCCAATCATTTCTCACCCTCTTCACAACCTCCAAACAATCAATCGAATCCTCCCTCACCCAAATCCAACAAACCCCAAACCCAGATCCCAATTCCGACCTCGAAAAAATCTCCAATTCCAT...
Protein
Download Protein FASTA510 aa · TkA05G110530|TK1151|PROTEIN
MNNHTDDTSTDPTTHRKHAAMIDRLSNLHQARLSTKPNPKDPTFESTQSFLTLFTTSKQSIESSLTQIQQTPNPDPNSDLEKISNSISDLEKLVAENSYFLPAYEVQSSLKTISDLKQTLDSVTSKVKPRKKFSFKNKPTKKPEPEPESESESKLQPESESKSSYTINDSPGFRGTKNATLTKDFTGMEIREFVLSDLTNCEVKLKGRFRTLFINRVRNCKIYVGPVSGSILIEEVEGCLFVLASHQIRVHDAKGTDFYL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA05G110530 |
|---|---|
| TK1151 ID | TkA05G110530 |
| OH-1004 ID | LXL04_019987 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 97.200 |
| Protein coverage (%) | TK1151 63.922 / OH-1004 97.898Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA05G110530 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr05:29636093-29645791 (-) | |||||||||
| Description | Similar to TFCC: Tubulin-folding cofactor C | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000226 microtubule cytoskeleton organization Biological Process GO:0006457 protein folding Biological Process GO:0007021 tubulin complex assembly Biological Process GO:0007023 post-chaperonin tubulin folding pathway Biological Process GO:0005737 cytoplasm Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005829 cytosol Cellular Component GO:0005856 cytoskeleton Cellular Component GO:0005874 microtubule Cellular Component GO:0003924 GTPase activity Molecular Function GO:0005096 GTPase activator activity Molecular Function GO:0015631 tubulin binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT4G39920 bta:515354 hsa:6903 mmu:72726 pon:100173755 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF16752TBCC_N23-131 aaPF24615Spectrin_Anc-1_251-125 aaPF27021BOS1_GOSR2_MEM11-like_N55-71 aaPF07160SKA165-195 aaPF14755Nsp2_AV68-88 aaPF05887Trypan_PARP72-77 aaPF27021BOS1_GOSR2_MEM11-like_N78-133 aaPF14755Nsp2_AV101-178 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA05G110530 | PF16752 | TBCC_N | 23 | 131 | 2.2e-25 | 89.9 |
| TkA05G110530 | PF24615 | Spectrin_Anc-1_2 | 51 | 125 | 0.27 | 12.2 |
| TkA05G110530 | PF27021 | BOS1_GOSR2_MEM11-like_N | 55 | 71 | 0.32 | 12.0 |
| TkA05G110530 | PF07160 | SKA1 | 65 | 195 | 0.012 | 16.1 |
| TkA05G110530 | PF14755 | Nsp2_AV | 68 | 88 | 0.29 | 12.1 |
| TkA05G110530 | PF05887 | Trypan_PARP | 72 | 77 | 0.35 | 11.6 |
| TkA05G110530 | PF27021 | BOS1_GOSR2_MEM11-like_N | 78 | 133 | 0.32 | 12.0 |
| TkA05G110530 | PF14755 | Nsp2_AV | 101 | 178 | 0.29 | 12.1 |
| TkA05G110530 | PF05887 | Trypan_PARP | 139 | 160 | 0.35 | 11.6 |
| TkA05G110530 | PF07986 | TBCC | 191 | 308 | 1.3e-36 | 125.8 |
| TkA05G110530 | PF16752 | TBCC_N | 463 | 480 | 2.2e-25 | 89.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.