TkA05G089100 | RubberDandelionOmics

Gene overview

TkA05G089100

Reference: TK1151 Chr: Chr05 Coordinates: 24068981-24078272 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

7471 bp · TkA05G089100|TK1151|cDNA

AAAGTTTTGTGTTCGTCTCCCACACCGCAACTCTCAAATCGATTTTTCGTACACAGAAACGAAGATTTGCAGGCGCAGATTCATCCTCAGCTATTCATTTCCGTCTTTGCTTGATCGATCTGTTGAATTAACTTTTTGTTCATTGAAAAAAAACGGTGAAGATTCGTTACGTTCCGATCCAGCGTTTCAGTTGGGTGAATTTCTTTTGTAAGTTTTGTTATGGATTCTAGGGCTTGCAATTCCGAGTAACTTTCACTGAT...

CDS

Download CDS FASTA

6579 bp · TkA05G089100|TK1151|CDS

ATGGGCGATGGAGGTGTTGCATGTGTTCCTTCGCTGCGATTCTCTATTTCCGAGACATTTTGCGGCGGTAATGACGGTGGTAAGTTCAATATCAGCGTTACAGAAGACAACGTGAAAATGAAGCTGGATAGAAGAGATAAGTTTCCTGTAAAAACTGGAGAGCTGTGTGATGATGAAAGTGAAGACTTGTCAGTAGAAGAGAGAGAAGATAAAGTTGTTGGGAACGGGCACAACAAGGAAGAAGTAGAAGAAGGTGAATT...

Protein

Download Protein FASTA

2192 aa · TkA05G089100|TK1151|PROTEIN

MGDGGVACVPSLRFSISETFCGGNDGGKFNISVTEDNVKMKLDRRDKFPVKTGELCDDESEDLSVEEREDKVVGNGHNKEEVEEGELGSWESGEFIPEKTRKFEIKSEIEKGDFVADRWRKGEVEKGEFIPGKWRKGGLQTGDYSSSRREFHSPESTLSKGAKDEMEKGEFIPDRWQRSEAVRDDNSYLKSRRHDSAKDKGWKQRTPGKYSGEKECNRNGNQYPKKSARWENNSRERNARISSKVVDEEGQLKEEFSNGK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G089100`
TK1151 ID	TkA05G089100
OH-1004 ID	LXL04_003523
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	35.100
Protein coverage (%)	TK1151 4.288 / OH-1004 8.094 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G089100

Location Chr05:24068981-24078272 (-)

Description Similar to ATX2: Histone-lysine N-methyltransferase ATX2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g15180`	Histone methyltransferase specifically required for trimethylation of 'Lys-4' of histone H3 (H3K4me3) and is crucial for both sporophyte and gametophyte development.	SET DOMAIN GROUP2 is the major histone H3 lysine [corrected] 4 trimethyltransferase in Arabidopsis.2010 · DOI: 10.1073/pnas.1010478107 Arabidopsis SET DOMAIN GROUP2 is required for H3K4 trimethylation and is crucial for both sporophyte and gametophyte development.2010 · DOI: 10.1105/tpc.110.079962 Diurnal regulation of SDG2 and JMJ14 by circadian clock oscillators orchestrates histone modification rhythms in Arabidopsis.2019 · DOI: 10.1186/s13059-019-1777-1

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003523 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009294 DNA-mediated transformation Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0010093 specification of floral organ identity Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

KEGG gene cross-reference

ath:AT1G05830

ath:AT2G31650

ath:AT4G27910

ath:AT5G53430

dosa:Os09g0134500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.879

Rank 1 · TkA05G089100 · TK1151

Cytoplasm0.146

Rank 2 · TkA05G089100 · TK1151

Cell membrane0.063

Rank 3 · TkA05G089100 · TK1151

Endoplasmic reticulum0.026

Rank 4 · TkA05G089100 · TK1151

Golgi apparatus0.015

Rank 5 · TkA05G089100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00856SET162-245 aa

PF16869CNDH2_M203-258 aa

PF16869CNDH2_M425-492 aa

PF25531GYF_ATXR3510-557 aa

PF02213GYF512-555 aa

PF14237GYF_2514-557 aa

PF16869CNDH2_M799-894 aa

PF25531GYF_ATXR3890-922 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G089100	`PF00856`	SET	162	245	5.1e-12	46.9
TkA05G089100	`PF16869`	CNDH2_M	203	258	0.25	12.8
TkA05G089100	`PF16869`	CNDH2_M	425	492	0.25	12.8
TkA05G089100	`PF25531`	GYF_ATXR3	510	557	1.9e-35	121.7
TkA05G089100	`PF02213`	GYF	512	555	0.0041	17.5
TkA05G089100	`PF14237`	GYF_2	514	557	4.3e-05	23.9
TkA05G089100	`PF16869`	CNDH2_M	799	894	0.25	12.8
TkA05G089100	`PF25531`	GYF_ATXR3	890	922	1.9e-35	121.7
TkA05G089100	`PF14237`	GYF_2	892	937	4.3e-05	23.9
TkA05G089100	`PF02213`	GYF	892	934	0.0041	17.5
TkA05G089100	`PF12937`	F-box-like	1061	1090	0.029	14.8
TkA05G089100	`PF16869`	CNDH2_M	1394	1447	0.25	12.8
TkA05G089100	`PF00856`	SET	1673	1760	5.1e-12	46.9
TkA05G089100	`PF19633`	SDG2_C	1771	2192	6.2e-233	774.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23372`	Arabidopsis thaliana	sp\|O23372\|ATXR3_ARATH Histone-lysine N-methyltransferase ATXR3	48.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card