TkA03G607380 | RubberDandelionOmics

Gene overview

TkA03G607380

Reference: TK1151 Chr: Chr03 Coordinates: 154262553-154265075 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1485 bp · TkA03G607380|TK1151|cDNA

ATGGAGAGACTACGCGACGGAATCGTCACCGTCCACTTTTACGATCTCCGACAGGCGACGGAGGCGCTTAACGAGATTCAAGAACAACACATGCAACAGCAATGCCGGCTTCGGAAACACTTTCAAGAACTTACGTTTTTGTCTCCACCCCCTCTCCCTCCACCGGCGCGTGGTCTTATATCCGGCCGCGCTATCTGGGCACAGTTTACTTTCCCCGTCACCGCTGGGCTTCCCGATGGTTACAACCAAGGCACTGTTGT...

CDS

Download CDS FASTA

1485 bp · TkA03G607380|TK1151|CDS

ATGGAGAGACTACGCGACGGAATCGTCACCGTCCACTTTTACGATCTCCGACAGGCGACGGAGGCGCTTAACGAGATTCAAGAACAACACATGCAACAGCAATGCCGGCTTCGGAAACACTTTCAAGAACTTACGTTTTTGTCTCCACCCCCTCTCCCTCCACCGGCGCGTGGTCTTATATCCGGCCGCGCTATCTGGGCACAGTTTACTTTCCCCGTCACCGCTGGGCTTCCCGATGGTTACAACCAAGGCACTGTTGT...

Protein

Download Protein FASTA

494 aa · TkA03G607380|TK1151|PROTEIN

MERLRDGIVTVHFYDLRQATEALNEIQEQHMQQQCRLRKHFQELTFLSPPPLPPPARGLISGRAIWAQFTFPVTAGLPDGYNQGTVVILNLDSDVSTAILRPILQAFGRVKEIRDTPLKRNQKSVEFYDTRDAAKAVAAVNGREINGKKVVVEFSRPGGYKHYHKQTKFNPINGNGIPAPPIISYNSPPPLRPPSPSPNRKDSVVDYAGNANDIGSPPRGGYKNNGKYFHKQEQPPEQHGRWVATGGGGGNSGRNKPWKG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G607380`
TK1151 ID	TkA03G607380
OH-1004 ID	LXL04_011637
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 81.924 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G607380

Location Chr03:154262553-154265075 (-)

Description Similar to PLA2: Protein terminal ear1 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g61960`	Probable RNA-binding transcriptional activator that plays a role in meiosis and vegetative growth.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2WY46`	Probable RNA-binding protein.	No verified direct reference in this release
`Os01g0907900`	Probable RNA-binding protein.	PLASTOCHRON2 regulates leaf initiation and maturation in rice.2006 · DOI: 10.1105/tpc.105.037622
`Os05g0102800`	Probable RNA-binding protein that may play a role in growth regulation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011637 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0005634 nucleus Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT5G61960

dosa:Os01g0907900

zma:541683

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.527

Rank 1 · TkA03G607380 · TK1151

Cytoplasm0.418

Rank 2 · TkA03G607380 · TK1151

Cell membrane0.153

Rank 3 · TkA03G607380 · TK1151

Endoplasmic reticulum0.052

Rank 4 · TkA03G607380 · TK1151

Plastid0.026

Rank 5 · TkA03G607380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076RRM_16-30 aa

PF29326RRM_MUD2_C7-43 aa

PF13893RRM_580-156 aa

PF16842RRM_occluded85-150 aa

PF00076RRM_186-150 aa

PF26726Helical_RasGEFs86-123 aa

PF29396F07F6_N113-158 aa

PF29326RRM_MUD2_C125-156 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G607380	`PF00076`	RRM_1	6	30	4.7e-12	46.3
TkA03G607380	`PF29326`	RRM_MUD2_C	7	43	0.038	14.8
TkA03G607380	`PF13893`	RRM_5	80	156	0.021	15.2
TkA03G607380	`PF16842`	RRM_occluded	85	150	0.00067	20.2
TkA03G607380	`PF00076`	RRM_1	86	150	4.7e-12	46.3
TkA03G607380	`PF26726`	Helical_RasGEFs	86	123	0.14	13.4
TkA03G607380	`PF29396`	F07F6_N	113	158	0.065	13.7
TkA03G607380	`PF29326`	RRM_MUD2_C	125	156	0.038	14.8
TkA03G607380	`PF04059`	RRM_2	287	393	1e-34	119.3
TkA03G607380	`PF00076`	RRM_1	290	307	4.7e-12	46.3
TkA03G607380	`PF00076`	RRM_1	329	362	4.7e-12	46.3
TkA03G607380	`PF29326`	RRM_MUD2_C	340	364	0.038	14.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W4I9`	Arabidopsis thaliana	sp\|Q8W4I9\|AML1_ARATH Protein MEI2-like 1	40.700%	Swiss-Prot	Low
`A2WY46`	Oryza sativa subsp. indica	sp\|A2WY46\|EAR1_ORYSI Protein terminal ear1 homolog	40.900%	Swiss-Prot	Medium
`Q0JGS5`	Oryza sativa subsp. japonica	sp\|Q0JGS5\|EAR1_ORYSJ Protein terminal ear1 homolog	40.700%	Swiss-Prot	Medium
`Q75M35`	Oryza sativa subsp. japonica	sp\|Q75M35\|OML3_ORYSJ Protein MEI2-like 3	46.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card