TkA03G561560 | RubberDandelionOmics

Gene overview

TkA03G561560

Reference: TK1151 Chr: Chr03 Coordinates: 142496569-142498595 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1738 bp · TkA03G561560|TK1151|cDNA

CTCCAATTAACTTTGTGCATCAATGGCTGTTAATGATCATCATATGAGACACATGGCGGCGGCGGCGGTGGCTCTTTAAAGCCCAACTGCTTCTGCCTCCTTTCGGGTCGAACCCGGCTTAAAGTATCCCTATCACACGCCATTCTCTCCCCTTTCTCTTGAAATCAAACACACGGTTCCAGATTAAACTCGATCAATCCGAAGAAGCTATTCGACTACAAAGTCAACTTATCGTCGTCTTCCTCTATTCTAGTCAAAGG...

CDS

Download CDS FASTA

1134 bp · TkA03G561560|TK1151|CDS

ATGGATGGTTCTCAAGGGGGTTCAAGTTCATCGCCTCCTTTCCTCATCAAAACATACGAAATGGTAGACGACCCTTTGACAGATCATATCGTTTCCTGGAGTCATACCGGAAGTAGTTTCGTCGTTTGGAATCCACCGGAATTTGCTAGCGAATTGCTTCCTAAATACTTCAAACACAACAATTTCTCCAGTTTCGTTCGACAACTCAATACATACGGTTTTAGAAAGATAGATCCCGACCAATGGGAGTTTGCAAACGA...

Protein

Download Protein FASTA

377 aa · TkA03G561560|TK1151|PROTEIN

MDGSQGGSSSSPPFLIKTYEMVDDPLTDHIVSWSHTGSSFVVWNPPEFASELLPKYFKHNNFSSFVRQLNTYGFRKIDPDQWEFANDEFLKGQRHLLKNIHRRKPIHSHSTPPQGTSPATLSPSERQEYEDDIQKLKNETTSLRLLLQRHKQENQEHEQKFALLREQVQKIQLRHKKTISFLAQILEKPGFLETNSKKRRMLITTYLHDEANSDDNNGNPDSVPLLNKLESSLKFWMDLVNDIVKVSGEETYDFGILTQP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G561560`
TK1151 ID	TkA03G561560
OH-1004 ID	LXL04_027419
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	39.400
Protein coverage (%)	TK1151 97.347 / OH-1004 98.082 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G561560

Location Chr03:142496569-142498595 (-)

Description Similar to HSFA4A: Heat stress transcription factor A-4a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g45710`	Transcriptional activator that specifically binds DNA sequence 5'-AGAAnnTTCT-3' known as heat shock promoter elements (HSE).	No verified direct reference in this release
`At4g18880`	Transcriptional activator that specifically binds DNA sequence 5'-AGAAnnTTCT-3' known as heat shock promoter elements (HSE).	No verified direct reference in this release
`At4g13980`	Transcriptional activator that specifically binds DNA sequence 5'-AGAAnnTTCT-3' known as heat shock promoter elements (HSE).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0749300`	Transcriptional regulator that specifically binds DNA of heat shock promoter elements (HSE).	No verified direct reference in this release
`Os03g0854500`	Transcriptional regulator that specifically binds DNA of heat shock promoter elements (HSE).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027419 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009408 response to heat Biological Process

GO:0009733 response to auxin Biological Process

GO:0009958 positive gravitropism Biological Process

GO:0034605 cellular response to heat Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048364 root development Biological Process

GO:0048527 lateral root development Biological Process

GO:0048530 fruit morphogenesis Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT4G18880

ath:AT5G45710

dosa:Os01g0749300

dosa:Os10g0419300

sly:101263626

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.901

Rank 1 · TkA03G561560 · TK1151

Cytoplasm0.190

Rank 2 · TkA03G561560 · TK1151

Cell membrane0.024

Rank 3 · TkA03G561560 · TK1151

Mitochondrion0.022

Rank 4 · TkA03G561560 · TK1151

Endoplasmic reticulum0.015

Rank 5 · TkA03G561560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00447HSF_DNA-bind14-103 aa

PF13476AAA_2347-171 aa

PF29363ENTR1120-181 aa

PF29075NOCA1_mid126-180 aa

PF00447HSF_DNA-bind166-198 aa

PF13476AAA_23234-285 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G561560	`PF00447`	HSF_DNA-bind	14	103	7.5e-31	107.3
TkA03G561560	`PF13476`	AAA_23	47	171	1.1	10.6
TkA03G561560	`PF29363`	ENTR1	120	181	0.003	18.0
TkA03G561560	`PF29075`	NOCA1_mid	126	180	0.027	15.1
TkA03G561560	`PF00447`	HSF_DNA-bind	166	198	7.5e-31	107.3
TkA03G561560	`PF13476`	AAA_23	234	285	1.1	10.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FK72`	Arabidopsis thaliana	sp\|Q9FK72\|HFA4C_ARATH Heat stress transcription factor A-4c	42.100%	Swiss-Prot	Medium
`O49403`	Arabidopsis thaliana	sp\|O49403\|HFA4A_ARATH Heat stress transcription factor A-4a	41.300%	Swiss-Prot	Medium
`Q94BZ5`	Arabidopsis thaliana	sp\|Q94BZ5\|HSFA5_ARATH Heat stress transcription factor A-5	49.300%	Swiss-Prot	Medium
`Q94J16`	Oryza sativa subsp. japonica	sp\|Q94J16\|HFA4B_ORYSJ Heat stress transcription factor A-4b	41.900%	Swiss-Prot	Medium
`Q84T61`	Oryza sativa subsp. japonica	sp\|Q84T61\|HSFA1_ORYSJ Heat stress transcription factor A-1	49.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card