LXL04_027419 | RubberDandelionOmics

Gene overview

LXL04_027419

Reference: OH-1004 Chr: Chr06 Coordinates: 15450086-15451267 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1098 bp · LXL04_027419|LXL04_027419|OH1004|cDNA

ATGAATGATGCTCAAAGTAGCGGCAGTAATACTCTGCCTCCGTTCATCGCCAAAACCTACGAAATGGTCGATGATCCGTTAACCGATACCATCGTATCATGGAGTCACAACGACCGGAGCTTCATTGTTTGGGACCCACCtgagttttccggcgaattgcTTCCGAGATATTTCAAGCACAATAATTTCTCGAGCTTTATCAGACAACTCAACACATATGGATTCCGGAAAATCGATCCAGAACAATGGGAATTTGCAAA...

CDS

Download CDS FASTA

1098 bp · LXL04_027419|LXL04_027419|OH1004|CDS

ATGAATGATGCTCAAAGTAGCGGCAGTAATACTCTGCCTCCGTTCATCGCCAAAACCTACGAAATGGTCGATGATCCGTTAACCGATACCATCGTATCATGGAGTCACAACGACCGGAGCTTCATTGTTTGGGACCCACCTGAGTTTTCCGGCGAATTGCTTCCGAGATATTTCAAGCACAATAATTTCTCGAGCTTTATCAGACAACTCAACACATATGGATTCCGGAAAATCGATCCAGAACAATGGGAATTTGCAAA...

Protein

Download Protein FASTA

365 aa · LXL04_027419|LXL04_027419|OH1004|PROTEIN

MNDAQSSGSNTLPPFIAKTYEMVDDPLTDTIVSWSHNDRSFIVWDPPEFSGELLPRYFKHNNFSSFIRQLNTYGFRKIDPEQWEFANEDFIRGQPHLLKNIHRKKPVHSHSLQNLHINGASASSFASSLTESERIRYKDDIYKLHHDKQSLSFEFQTLQHEQDEIESAARGLTERLRAAGRNQKDLLCTLDQILQKPVNIFDFTPQIPDNNDRKRRLSAEPNNHQSCSCNNPISETLTTNTLLALDLDLVEQLESSLMFC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027419`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027419

Location Chr06:15450086-15451267 (-)

Description Similar to HSFA4A: Heat stress transcription factor A-4a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18880`	Transcriptional activator that specifically binds DNA sequence 5'-AGAAnnTTCT-3' known as heat shock promoter elements (HSE).	No verified direct reference in this release
`At5g45710`	Transcriptional activator that specifically binds DNA sequence 5'-AGAAnnTTCT-3' known as heat shock promoter elements (HSE).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0749300`	Transcriptional regulator that specifically binds DNA of heat shock promoter elements (HSE).	No verified direct reference in this release
`Os10g0419300`	Transcriptional activator that specifically binds DNA of heat shock promoter elements (HSE).	Isolation and characterization of a cDNA encoding two novel heat-shock factor OsHSF6 and OsHSF12 in Oryza sativa L.2005 · DOI: 10.5483/bmbrep.2005.38.5.602

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027419 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009408 response to heat Biological Process

GO:0009733 response to auxin Biological Process

GO:0009958 positive gravitropism Biological Process

GO:0034605 cellular response to heat Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048364 root development Biological Process

GO:0048527 lateral root development Biological Process

GO:0048530 fruit morphogenesis Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT4G18880

ath:AT5G45710

dosa:Os01g0749300

dosa:Os10g0419300

sly:101263626

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.847

Rank 1 · LXL04_027419 · OH-1004

Cytoplasm0.279

Rank 2 · LXL04_027419 · OH-1004

Mitochondrion0.025

Rank 3 · LXL04_027419 · OH-1004

Cell membrane0.019

Rank 4 · LXL04_027419 · OH-1004

Lysosome / Vacuole0.013

Rank 5 · LXL04_027419 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00447.24HSF_DNA-bind15-104 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027419	`PF00447.24`	HSF_DNA-bind	15	104	4.2e-31	108.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49403`	Arabidopsis thaliana	Heat stress transcription factor A-4a	41.147%	Swiss-Prot	moderate database homology
`Q9FK72`	Arabidopsis thaliana	Heat stress transcription factor A-4c	40.054%	Swiss-Prot	moderate database homology
`Q94J16`	Oryza sativa subsp. japonica	Heat stress transcription factor A-4b	44.444%	Swiss-Prot	moderate database homology
`Q338B0`	Oryza sativa subsp. japonica	Heat stress transcription factor A-2c	34.384%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card