TkA03G033950 | RubberDandelionOmics

Gene overview

TkA03G033950

Reference: TK1151 Chr: Chr03 Coordinates: 8980432-8983481 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1241 bp · TkA03G033950|TK1151|cDNA

ATGCATACAACGATTGTTAATTTCTCTAATGCTGCGCTGCTTGGGTCCGATACATCACTGCCTGGCTTGGTTGCTGCAAAAGTAGGTGCATATGTCGTTCTTACCGATGACTCCAACAGACTAGAGGTTCTAGAAAACATGAGAAAAGTGTGTGAGCTAAATTATATCAAGTTTGAGGTTTCACCACATTTTTGCGGTGATGGAAGTGTGAGCTATGGAATGGACGATGCTGATGATGTTTACATGCAGTCATGGACTGG...

CDS

Download CDS FASTA

1026 bp · TkA03G033950|TK1151|CDS

ATGCATACAACGATTGTTAATTTCTCTAATGCTGCGCTGCTTGGGTCCGATACATCACTGCCTGGCTTGGTTGCTGCAAAAGTAGGTGCATATGTCGTTCTTACCGATGACTCCAACAGACTAGAGGTTCTAGAAAACATGAGAAAAGTGTGTGAGCTAAATTATATCAAGTTTGAGGTTTCACCACATTTTTGCGGTGATGGAAGTGTGAGCTATGGAATGGACGATGCTGATGATGTTTACATGCAGTCATGGACTGG...

Protein

Download Protein FASTA

341 aa · TkA03G033950|TK1151|PROTEIN

MHTTIVNFSNAALLGSDTSLPGLVAAKVGAYVVLTDDSNRLEVLENMRKVCELNYIKFEVSPHFCGDGSVSYGMDDADDVYMQSWTGTIIGPSNTVHEGRIYQLKLFCCLEYPEKPPTVKFQPRINMSWVNQETGVVEPSLFPMLSQLKKEMTSPHNRRFTQPPEVFPKWVNTQERNERPSENCCSHMDLRMDFLLVLWTKALPYTVFQPQALELCARKVAASSGDMRKALGICRGAIERLETELRDDTCTSNLTSMVRV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G033950`
TK1151 ID	TkA03G033950
OH-1004 ID	LXL04_033518
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	35.100
Protein coverage (%)	TK1151 99.707 / OH-1004 89.237 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G033950

Location Chr03:8980432-8983481 (-)

Description Similar to ELM1: Mitochondrial fission protein ELM1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g23260`	Has no ubiquitin ligase activity on its own.	No verified direct reference in this release
`At3g52560`	Has no ubiquitin ligase activity on its own.	Arabidopsis UEV1D promotes Lysine-63-linked polyubiquitination and is involved in DNA damage response.2008 · DOI: 10.1105/tpc.107.051862
`At2g36060`	Has no ubiquitin ligase activity on its own.	No verified direct reference in this release
`At1g70660`	Has no ubiquitin ligase activity on its own.	No verified direct reference in this release
`At1g07270`	May be involved in the initiation of DNA replication.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033518 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000266 mitochondrial fission Biological Process

GO:0006270 DNA replication initiation Biological Process

GO:0033314 mitotic DNA replication checkpoint signaling Biological Process

GO:0042023 DNA endoreduplication Biological Process

GO:0051301 cell division Biological Process

GO:0140530 MCM complex loading Biological Process

GO:1902975 mitotic DNA replication initiation Biological Process

GO:1902985 mitotic pre-replicative complex assembly Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005656 nuclear pre-replicative complex Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

KEGG gene cross-reference

ath:AT1G07270

ath:AT2G29680

ath:AT5G22350

dosa:Os01g0856000

osa:4324832

spo:2540013

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.409

Rank 1 · TkA03G033950 · TK1151

Cytoplasm0.385

Rank 2 · TkA03G033950 · TK1151

Mitochondrion0.128

Rank 3 · TkA03G033950 · TK1151

Cell membrane0.106

Rank 4 · TkA03G033950 · TK1151

Endoplasmic reticulum0.091

Rank 5 · TkA03G033950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00179UQ_con79-137 aa

PF22606Cdc6-ORC-like_ATPase_lid206-244 aa

PF22703Cdc6_lid206-238 aa

PF17872AAA_lid_10209-242 aa

PF06258Mito_fiss_Elm1287-340 aa

PF22606Cdc6-ORC-like_ATPase_lid325-339 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G033950	`PF00179`	UQ_con	79	137	7e-10	39.4
TkA03G033950	`PF22606`	Cdc6-ORC-like_ATPase_lid	206	244	8.8e-07	29.5
TkA03G033950	`PF22703`	Cdc6_lid	206	238	0.037	14.6
TkA03G033950	`PF17872`	AAA_lid_10	209	242	5.3e-05	24.0
TkA03G033950	`PF06258`	Mito_fiss_Elm1	287	340	1.4e-19	71.1
TkA03G033950	`PF22606`	Cdc6-ORC-like_ATPase_lid	325	339	8.8e-07	29.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93YP0`	Arabidopsis thaliana	sp\|Q93YP0\|UEV1A_ARATH Ubiquitin-conjugating enzyme E2 variant 1A	67.300%	Swiss-Prot	Low
`Q9SVD7`	Arabidopsis thaliana	sp\|Q9SVD7\|UEV1D_ARATH Ubiquitin-conjugating enzyme E2 variant 1D	64.600%	Swiss-Prot	Low
`Q9SJ44`	Arabidopsis thaliana	sp\|Q9SJ44\|UEV1C_ARATH Ubiquitin-conjugating enzyme E2 variant 1C	63.700%	Swiss-Prot	Low
`Q9CAB6`	Arabidopsis thaliana	sp\|Q9CAB6\|UEV1B_ARATH Ubiquitin-conjugating enzyme E2 variant 1B	64.000%	Swiss-Prot	Low
`Q8W032`	Arabidopsis thaliana	sp\|Q8W032\|CDC6B_ARATH DNA replication factor CDC6B	52.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card