TkA01G558670 | RubberDandelionOmics

Gene overview

TkA01G558670

Reference: TK1151 Chr: Chr01 Coordinates: 140527642-140531657 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2569 bp · TkA01G558670|TK1151|cDNA

CTCACATCCAGTAATGGCGTTTCTGTTAGCCATGAATATCCAAATGACCACAGCTCGAAGCATGTCTTCGAATTCATCACAAATGTGTCCTCGTTTCGAGCTACCGCAAAGATTCTTTCTCGTGAGGCCCTCGCGATATCAAAAACCTATCACGAGAATCGTTTGCATGGCGGAGCCTTATCTTCTAAAGAAACTCGAATCTGCTGAGAACACCTGGAAAGAACTATCGGTTAAGCTAGCAGATCCGGATGTGGTTTCAA...

CDS

Download CDS FASTA

1248 bp · TkA01G558670|TK1151|CDS

ATGGCGTTTCTGTTAGCCATGAATATCCAAATGACCACAGCTCGAAGCATGTCTTCGAATTCATCACAAATGTGTCCTCGTTTCGAGCTACCGCAAAGATTCTTTCTCGTGAGGCCCTCGCGATATCAAAAACCTATCACGAGAATCGTTTGCATGGCGGAGCCTTATCTTCTAAAGAAACTCGAATCTGCTGAGAACACCTGGAAAGAACTATCGGTTAAGCTAGCAGATCCGGATGTGGTTTCAAATCCTAGCGAGTA...

Protein

Download Protein FASTA

415 aa · TkA01G558670|TK1151|PROTEIN

MAFLLAMNIQMTTARSMSSNSSQMCPRFELPQRFFLVRPSRYQKPITRIVCMAEPYLLKKLESAENTWKELSVKLADPDVVSNPSEYQKLAQSMSELDTVVATYKGFKECEKQLEESKVLSKDADVDEDMAEMIASEIESLSEQLKVYEEKLKMLLIPSDPLDARNILLEVRAGTGGEEAGLWAADLVRMYQRYSERNSLKYTPLSCSEAERGGYKTYVMEVKGARVYSKLKYESGVHRVQRVPQTEAQGRIHTSTATVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G558670`
TK1151 ID	TkA01G558670
OH-1004 ID	LXL04_001129
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G558670

Location Chr01:140527642-140531657 (-)

Description Similar to APG3: Peptide chain release factor APG3, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g62910`	May direct the termination of translation in response to the peptide chain termination codon UAG.	Chloroplast ribosome release factor 1 (AtcpRF1) is essential for chloroplast development.2007 · DOI: 10.1007/s11103-007-9166-7

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001129 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006415 translational termination Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0032544 plastid translation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003747 translation release factor activity Molecular Function

GO:0016149 translation release factor activity, codon specific Molecular Function

KEGG gene cross-reference

ana:all4185

ath:AT3G62910

mar:MAE_53410

tel:tlr0148

ter:Tery_2982

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.746

Rank 1 · TkA01G558670 · TK1151

Mitochondrion0.291

Rank 2 · TkA01G558670 · TK1151

Nucleus0.048

Rank 3 · TkA01G558670 · TK1151

Cytoplasm0.044

Rank 4 · TkA01G558670 · TK1151

Peroxisome0.012

Rank 5 · TkA01G558670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16326ABC_tran_CTD59-99 aa

PF03462PCRF65-259 aa

PF30842LEKR186-155 aa

PF02482Ribosomal_S30AE98-153 aa

PF15188CCDC-167106-155 aa

PF16326ABC_tran_CTD133-153 aa

PF00472RF-1266-376 aa

PF02482Ribosomal_S30AE267-300 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G558670	`PF16326`	ABC_tran_CTD	59	99	0.00041	21.2
TkA01G558670	`PF03462`	PCRF	65	259	1.9e-68	230.8
TkA01G558670	`PF30842`	LEKR1	86	155	0.34	12.0
TkA01G558670	`PF02482`	Ribosomal_S30AE	98	153	0.21	13.0
TkA01G558670	`PF15188`	CCDC-167	106	155	0.051	14.6
TkA01G558670	`PF16326`	ABC_tran_CTD	133	153	0.00041	21.2
TkA01G558670	`PF00472`	RF-1	266	376	2.6e-38	131.2
TkA01G558670	`PF02482`	Ribosomal_S30AE	267	300	0.21	13.0
TkA01G558670	`PF15188`	CCDC-167	316	339	0.051	14.6
TkA01G558670	`PF30842`	LEKR1	316	350	0.34	12.0
TkA01G558670	`PF03462`	PCRF	327	401	1.9e-68	230.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RX79`	Arabidopsis thaliana	sp\|Q8RX79\|APG3_ARATH Peptide chain release factor APG3, chloroplastic	76.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card