LXL04_001129 | RubberDandelionOmics

Gene overview

LXL04_001129

Reference: OH-1004 Chr: Chr01 Coordinates: 20798067-20800775 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1248 bp · LXL04_001129|LXL04_001129|OH1004|cDNA

ATGGCGTTTCTGTTAGCCATGAATATCCAAATGACCACAGCTCGAAGCATGTCTTCGAATTCATCACAAATGTGTCCTCGTTTCGAGCTACCGCAAAGATTCTTTCTCGTGAGGCCCTCGCGATATCAAAAACCTATCACGAGAATCGTTTGCATGGCGGAGCCTTATCTTCTAAAGAAACTCGAATCTGCTGAGAACACCTGGAAAGAACTATCGGTTAAGCTAGCAGATCCGGATGTGGTTTCAAATCCTAGCGAGTA...

CDS

Download CDS FASTA

1248 bp · LXL04_001129|LXL04_001129|OH1004|CDS

ATGGCGTTTCTGTTAGCCATGAATATCCAAATGACCACAGCTCGAAGCATGTCTTCGAATTCATCACAAATGTGTCCTCGTTTCGAGCTACCGCAAAGATTCTTTCTCGTGAGGCCCTCGCGATATCAAAAACCTATCACGAGAATCGTTTGCATGGCGGAGCCTTATCTTCTAAAGAAACTCGAATCTGCTGAGAACACCTGGAAAGAACTATCGGTTAAGCTAGCAGATCCGGATGTGGTTTCAAATCCTAGCGAGTA...

Protein

Download Protein FASTA

415 aa · LXL04_001129|LXL04_001129|OH1004|PROTEIN

MAFLLAMNIQMTTARSMSSNSSQMCPRFELPQRFFLVRPSRYQKPITRIVCMAEPYLLKKLESAENTWKELSVKLADPDVVSNPSEYQKLAQSMSELDTVVATYKGFKECEKQLEESKVLSKDADVDEDMAEMIASEIESLSEQLKVYEEKLKMLLIPSDPLDARNILLEVRAGTGGEEAGLWAADLVRMYQRYSERNSLKYTPLSCSEAERGGYKTYVMEVKGARVYSKLKYESGVHRVQRVPQTEAQGRIHTSTATVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001129`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001129

Location Chr01:20798067-20800775 (+)

Description Similar to APG3: Peptide chain release factor APG3, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g62910`	May direct the termination of translation in response to the peptide chain termination codon UAG.	Chloroplast ribosome release factor 1 (AtcpRF1) is essential for chloroplast development.2007 · DOI: 10.1007/s11103-007-9166-7

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001129 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006415 translational termination Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0032544 plastid translation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003747 translation release factor activity Molecular Function

GO:0016149 translation release factor activity, codon specific Molecular Function

KEGG gene cross-reference

ana:all4185

ath:AT3G62910

mar:MAE_53410

tel:tlr0148

ter:Tery_2982

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.746

Rank 1 · LXL04_001129 · OH-1004

Mitochondrion0.291

Rank 2 · LXL04_001129 · OH-1004

Nucleus0.048

Rank 3 · LXL04_001129 · OH-1004

Cytoplasm0.044

Rank 4 · LXL04_001129 · OH-1004

Peroxisome0.012

Rank 5 · LXL04_001129 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03462.24PCRF65-259 aa

PF00472.27RF-1266-376 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001129	`PF03462.24`	PCRF	65	259	1.9e-68	230.8
LXL04_001129	`PF00472.27`	RF-1	266	376	2.6e-38	131.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RX79`	Arabidopsis thaliana	Peptide chain release factor APG3, chloroplastic	77.808%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card