TkA01G458000 | RubberDandelionOmics

Gene overview

TkA01G458000

Reference: TK1151 Chr: Chr01 Coordinates: 114682069-114683740 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1377 bp · TkA01G458000|TK1151|cDNA

ATGGCAATAAAGATCGTAAAAGCACAACCACCTGTTGAGTTATCAAAGATTGCAGTTTCAGAAACCCATGGAGAAAACTCTCCATATTTTGCTGGATGGAAAGCTTACGATGAAAACCCATATCATGAAAAACATAACCCTCATGGGGTTATACAAATGGGGTTAGCTGAAAATCAAGTTTCATTCGATTTACTTGAAGAATACTTGGCTTCTAATCAAGAAGCGGCAAGTTGGGGCAAAAAGGTTTCTGGTTTTAGAGA...

CDS

Download CDS FASTA

1377 bp · TkA01G458000|TK1151|CDS

ATGGCAATAAAGATCGTAAAAGCACAACCACCTGTTGAGTTATCAAAGATTGCAGTTTCAGAAACCCATGGAGAAAACTCTCCATATTTTGCTGGATGGAAAGCTTACGATGAAAACCCATATCATGAAAAACATAACCCTCATGGGGTTATACAAATGGGGTTAGCTGAAAATCAAGTTTCATTCGATTTACTTGAAGAATACTTGGCTTCTAATCAAGAAGCGGCAAGTTGGGGCAAAAAGGTTTCTGGTTTTAGAGA...

Protein

Download Protein FASTA

458 aa · TkA01G458000|TK1151|PROTEIN

MAIKIVKAQPPVELSKIAVSETHGENSPYFAGWKAYDENPYHEKHNPHGVIQMGLAENQVSFDLLEEYLASNQEAASWGKKVSGFRENALFQDYHGLLTFRKAMASFMEQVRGGKAKFDPERVVLTAGATAANELLTFILANPGDALLVPTPYYPGFDRDLRWRTGVEIVPIHCESSNNFQITPEALESAYDHASSMNMKVRGVLITNPSNPLGATIQRKVLEQILDFVTRKNIHLVSDEIYSGSVFHSDEFVSIAEILE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G458000`
TK1151 ID	TkA01G458000
OH-1004 ID	LXL04_002461
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	97.800
Protein coverage (%)	TK1151 97.380 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G458000

Location Chr01:114682069-114683740 (+)

Description Similar to ACS7: 1-aminocyclopropane-1-carboxylate synthase 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g26200`	1-aminocyclopropane-1-carboxylate synthase (ACS) enzymes catalyze the conversion of S-adenosyl-L-methionine (SAM) into 1-aminocyclopropane-1-carboxylate (ACC), a direct precursor of ethylene.	No verified direct reference in this release
`At4g37770`	1-aminocyclopropane-1-carboxylate synthase (ACS) enzymes catalyze the conversion of S-adenosyl-L-methionine (SAM) into 1-aminocyclopropane-1-carboxylate (ACC), a direct precursor of ethylene.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0192900`	Catalyzes the formation of 1-aminocyclopropane-1-carboxylate, a direct precursor of ethylene in higher plants.	No verified direct reference in this release
`Os05g0319200`	Catalyzes the formation of 1-aminocyclopropane-1-carboxylate, a direct precursor of ethylene in higher plants.	No verified direct reference in this release
`Os05g0196600`	Catalyzes the formation of 1-aminocyclopropane-1-carboxylate, a direct precursor of ethylene in higher plants.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002461 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006520 amino acid metabolic process Biological Process

GO:0009693 ethylene biosynthetic process Biological Process

GO:0009835 fruit ripening Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0008483 transaminase activity Molecular Function

GO:0016847 1-aminocyclopropane-1-carboxylate synthase activity Molecular Function

GO:0030170 pyridoxal phosphate binding Molecular Function

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT4G26200

ath:AT4G37770

dosa:Os01g0192900

osa:107275635

osa:107275928

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.606

Rank 1 · TkA01G458000 · TK1151

Nucleus0.228

Rank 2 · TkA01G458000 · TK1151

Plastid0.110

Rank 3 · TkA01G458000 · TK1151

Peroxisome0.101

Rank 4 · TkA01G458000 · TK1151

Mitochondrion0.077

Rank 5 · TkA01G458000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00155Aminotran_1_251-430 aa

PF20306Sp-DndD56-79 aa

PF01212Beta_elim_lyase118-331 aa

PF18604PreAtp-grasp139-188 aa

PF29197FlhF_2nd216-225 aa

PF18604PreAtp-grasp301-331 aa

PF29197FlhF_2nd319-341 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G458000	`PF00155`	Aminotran_1_2	51	430	6.8e-99	332.2
TkA01G458000	`PF20306`	Sp-DndD	56	79	0.18	12.7
TkA01G458000	`PF01212`	Beta_elim_lyase	118	331	2.1e-05	24.7
TkA01G458000	`PF18604`	PreAtp-grasp	139	188	0.03	15.6
TkA01G458000	`PF29197`	FlhF_2nd	216	225	0.34	11.7
TkA01G458000	`PF18604`	PreAtp-grasp	301	331	0.03	15.6
TkA01G458000	`PF29197`	FlhF_2nd	319	341	0.34	11.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9STR4`	Arabidopsis thaliana	sp\|Q9STR4\|1A17_ARATH 1-aminocyclopropane-1-carboxylate synthase 7	78.100%	Swiss-Prot	High
`Q9T065`	Arabidopsis thaliana	sp\|Q9T065\|1A18_ARATH 1-aminocyclopropane-1-carboxylate synthase 8	61.300%	Swiss-Prot	High
`A0A0P0UZP7`	Oryza sativa subsp. japonica	sp\|A0A0P0UZP7\|1A15_ORYSJ 1-aminocyclopropane-1-carboxylate synthase 5	67.000%	Swiss-Prot	High
`Q5W6F9`	Oryza sativa subsp. japonica	sp\|Q5W6F9\|1A14_ORYSJ 1-aminocyclopropane-1-carboxylate synthase 4	63.900%	Swiss-Prot	High
`A0A0P0WIY3`	Oryza sativa subsp. japonica	sp\|A0A0P0WIY3\|1A13_ORYSJ 1-aminocyclopropane-1-carboxylate synthase 3	64.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card