LXL04_036628 | RubberDandelionOmics

Gene overview

LXL04_036628

Reference: OH-1004 Chr: Chr08 Coordinates: 45669959-45672354 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1557 bp · LXL04_036628|LXL04_036628|OH1004|cDNA

ATGGACCAAAATGTAATTATACAAAGTAAAGGGGCTGGTAGAGTGTGTTCTTCGATCACAATTTTATCATCCGAGCTCGCAAGCACAACTCCCATGGCGACATCTACCCCCTTATTCAGTCTCTCCCATCTTAATCACAAACAAACCACCTCCAAACGATTGTTATTAAACCCTAATTGCAAAGCCAAAATCATACGAATCCTCTGTTCTTCCTCATCTTCATTTCCTCAATCTACCATTACTCACGAAACCATAACTCC...

CDS

Download CDS FASTA

1557 bp · LXL04_036628|LXL04_036628|OH1004|CDS

ATGGACCAAAATGTAATTATACAAAGTAAAGGGGCTGGTAGAGTGTGTTCTTCGATCACAATTTTATCATCCGAGCTCGCAAGCACAACTCCCATGGCGACATCTACCCCCTTATTCAGTCTCTCCCATCTTAATCACAAACAAACCACCTCCAAACGATTGTTATTAAACCCTAATTGCAAAGCCAAAATCATACGAATCCTCTGTTCTTCCTCATCTTCATTTCCTCAATCTACCATTACTCACGAAACCATAACTCC...

Protein

Download Protein FASTA

518 aa · LXL04_036628|LXL04_036628|OH1004|PROTEIN

MDQNVIIQSKGAGRVCSSITILSSELASTTPMATSTPLFSLSHLNHKQTTSKRLLLNPNCKAKIIRILCSSSSSFPQSTITHETITPLPPNNSVNNVTPQNKWEAHRKRKVLMRVGYAGINTGSKRYQFLKVLFCYIALEKELETAIYNAGGIRDSNFGDLQKIAWATSSQFDDEIHSLSTMISLKMEIPEYAWINDPNGTLLADTVNTYLPKNIRVFSILPSQKGFDAKKECNMRKYGYLLPLELIGINSNFTKSEVEH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036628`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036628

Location Chr08:45669959-45672354 (-)

Description Similar to At2g30320: Putative tRNA pseudouridine synthase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g30320`	Putative tRNA pseudouridine synthase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036628 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0031119 tRNA pseudouridine synthesis Biological Process

GO:0031120 snRNA pseudouridine synthesis Biological Process

GO:0070902 mitochondrial tRNA pseudouridine synthesis Biological Process

GO:1990481 mRNA pseudouridine synthesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005667 transcription regulator complex Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT2G30320

cgr:2887466

hsa:80324

kla:KLLA0_B02244g

sce:YGL063W

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.477

Rank 1 · LXL04_036628 · OH-1004

Plastid0.291

Rank 2 · LXL04_036628 · OH-1004

Nucleus0.145

Rank 3 · LXL04_036628 · OH-1004

Cytoplasm0.075

Rank 4 · LXL04_036628 · OH-1004

Cell membrane0.011

Rank 5 · LXL04_036628 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01416.26PseudoU_synth_1272-414 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036628	`PF01416.26`	PseudoU_synth_1	272	414	6.1e-08	33.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22928`	Arabidopsis thaliana	Putative tRNA pseudouridine synthase	46.154%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card