LXL04_027553 | RubberDandelionOmics

Gene overview

LXL04_027553

Reference: OH-1004 Chr: Chr06 Coordinates: 18843661-18845664 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1848 bp · LXL04_027553|LXL04_027553|OH1004|cDNA

ATGGCGGCCACTTTAAAGTCAGTCAACCACCGTCATCAACCGCTCTCAGCTGCTAGCCAGAACCACGTCCGCCGCCTTGTAACTGCATCTTTCAACGAGGTTGCGATTAACGACGGTGATAAGAGATCAAATAAGTCAACTCGCCTAGCGAAATCGATCACGAACCTCTTGAATCTGTATATCGACAAGCCATCGCTGAAACACTTTCTCCAACGTCATGACTGGGATGTTGTTGCTCAGGCGGAGGCGAAGCTAGAGTT...

CDS

Download CDS FASTA

1848 bp · LXL04_027553|LXL04_027553|OH1004|CDS

ATGGCGGCCACTTTAAAGTCAGTCAACCACCGTCATCAACCGCTCTCAGCTGCTAGCCAGAACCACGTCCGCCGCCTTGTAACTGCATCTTTCAACGAGGTTGCGATTAACGACGGTGATAAGAGATCAAATAAGTCAACTCGCCTAGCGAAATCGATCACGAACCTCTTGAATCTGTATATCGACAAGCCATCGCTGAAACACTTTCTCCAACGTCATGACTGGGATGTTGTTGCTCAGGCGGAGGCGAAGCTAGAGTT...

Protein

Download Protein FASTA

615 aa · LXL04_027553|LXL04_027553|OH1004|PROTEIN

MAATLKSVNHRHQPLSAASQNHVRRLVTASFNEVAINDGDKRSNKSTRLAKSITNLLNLYIDKPSLKHFLQRHDWDVVAQAEAKLELPTMSPKEDISSIWRDIHGGSDWENLLDPLHPFVRRELIKYGEFSQATYDAFDFDSFSEYCGSCLFSRRKFFDKLGLTKHGYDVTKYIYAMSQFEIPRWLEKSYVTDTWSKDSNWMGYVAVSDDLESKRIGRRDIVVAWRGTVLPSEWYEDMQRDLEPLGHGEAKVERGFLSIY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027553`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027553

Location Chr06:18843661-18845664 (-)

Description Similar to At1g06800: Phospholipase A1-Igamma1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g06800`	Acylhydrolase with a broad specificity.	DONGLE and DEFECTIVE IN ANTHER DEHISCENCE1 lipases are not essential for wound- and pathogen-induced jasmonate biosynthesis: redundant lipases contribute to jasmonate formation.2010 · DOI: 10.1104/pp.110.155093
`At2g30550`	Acylhydrolase with broad specificity.	No verified direct reference in this release
`At1g51440`	Acylhydrolase that catalyzes the hydrolysis of phosphatidylcholine at the sn-1 position.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0651100`	Acylhydrolase that catalyzes the hydrolysis of phospholipids at the sn-1 position.	No verified direct reference in this release
`UniProt: A2WT95`	Acylhydrolase that catalyzes the hydrolysis of phospholipids at the sn-1 position.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027553 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016042 lipid catabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004620 glycerophospholipase activity Molecular Function

GO:0004806 triacylglycerol lipase activity Molecular Function

GO:0008970 glycerophospholipid phospholipase A1 activity Molecular Function

GO:0047714 galactolipase activity Molecular Function

KEGG gene cross-reference

ath:AT1G06800

ath:AT1G51440

ath:AT2G30550

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.798

Rank 1 · LXL04_027553 · OH-1004

Cytoplasm0.102

Rank 2 · LXL04_027553 · OH-1004

Mitochondrion0.078

Rank 3 · LXL04_027553 · OH-1004

Peroxisome0.067

Rank 4 · LXL04_027553 · OH-1004

Lysosome / Vacuole0.062

Rank 5 · LXL04_027553 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01764.32Lipase_3222-369 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027553	`PF01764.32`	Lipase_3	222	369	7.1e-33	114.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q941F1`	Arabidopsis thaliana	Phospholipase A1-Igamma1, chloroplastic	47.783%	Swiss-Prot	moderate database homology
`Q3EBR6`	Arabidopsis thaliana	Phospholipase A1-Igamma2, chloroplastic	44.573%	Swiss-Prot	moderate database homology
`Q9C8J6`	Arabidopsis thaliana	Phospholipase A1-Igamma3, chloroplastic	44.366%	Swiss-Prot	moderate database homology
`A2ZW16`	Oryza sativa subsp. japonica	Phospholipase A1-II 1	40.247%	Swiss-Prot	moderate database homology
`A2WT95`	Oryza sativa subsp. indica	Phospholipase A1-II 1	40.247%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card