LXL04_024197 | RubberDandelionOmics

Gene overview

LXL04_024197

Reference: OH-1004 Chr: Chr05 Coordinates: 84334784-84338102 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1401 bp · LXL04_024197|LXL04_024197|OH1004|cDNA

ATGGCTTTTTTCACAGTTATTATTGGTGTTGTATTGGGACTTTGCCTCTTAAGCACTGCCCTTTTGAGATGGAATGAGATGAAGTACAAGAAGAAAGGCCTACCTCCTGGTACCATGGGTTGGCCACTTTTTGGTGAGACCACCGATTTCCTCAAACAAGGCCCCAGCTTCATGAAAAACCAGAGAGCAAGGTATGGCAGTGTGTTCAAATCTCATATCTTGGGATGCCCGACAATCGTTTCAATGGATCCACAGCTTAA...

CDS

Download CDS FASTA

1401 bp · LXL04_024197|LXL04_024197|OH1004|CDS

ATGGCTTTTTTCACAGTTATTATTGGTGTTGTATTGGGACTTTGCCTCTTAAGCACTGCCCTTTTGAGATGGAATGAGATGAAGTACAAGAAGAAAGGCCTACCTCCTGGTACCATGGGTTGGCCACTTTTTGGTGAGACCACCGATTTCCTCAAACAAGGCCCCAGCTTCATGAAAAACCAGAGAGCAAGGTATGGCAGTGTGTTCAAATCTCATATCTTGGGATGCCCGACAATCGTTTCAATGGATCCACAGCTTAA...

Protein

Download Protein FASTA

466 aa · LXL04_024197|LXL04_024197|OH1004|PROTEIN

MAFFTVIIGVVLGLCLLSTALLRWNEMKYKKKGLPPGTMGWPLFGETTDFLKQGPSFMKNQRARYGSVFKSHILGCPTIVSMDPQLNKFILMNEGKGILPGYPQSMLDILGKSNIAAVHGPAHKNMRGALLSLVSPTMIREQILPKIDDFIRSHLHNWNNQIVDIQEKTKEMALLSSIKQIFGAETCSLSKEFMPEFFKLVLGTLSLPINLPNTNYHRGLQARKNIVRMLGELIDERRGSEETHHDMLSQLMSGVDNRYK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024197`
TK1151 ID	TkA06G165450
OH-1004 ID	LXL04_024197
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 94.421 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024197

Location Chr05:84334784-84338102 (+)

Description Similar to CYP85A1: Cytochrome P450 85A1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g30180`	Mediates Baeyer-Villiger oxidation and catalyzes the C6- oxidation step and lactonization in brassinosteroids biosynthesis.	Organ-specific expression of brassinosteroid-biosynthetic genes and distribution of endogenous brassinosteroids in Arabidopsis.2003 · DOI: 10.1104/pp.013029 The last reaction producing brassinolide is catalyzed by cytochrome P-450s, CYP85A3 in tomato and CYP85A2 in Arabidopsis.2005 · DOI: 10.1074/jbc.m414592200 Arabidopsis CYP85A2, a cytochrome P450, mediates the Baeyer-Villiger oxidation of castasterone to brassinolide in brassinosteroid biosynthesis.2005 · DOI: 10.1105/tpc.105.033738 Arabidopsis CYP85A2 catalyzes lactonization reactions in the biosynthesis of 2-deoxy-7-oxalactone brassinosteroids.2008 · DOI: 10.1271/bbb.80192 Biosynthesis of a cholesterol-derived brassinosteroid, 28-norcastasterone, in Arabidopsis thaliana.2012 · DOI: 10.1093/jxb/err354 Farnesylation mediates brassinosteroid biosynthesis to regulate abscisic acid responses.2016 · DOI: 10.1038/nplants.2016.114

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024197 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001578 microtubule bundle formation Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009647 skotomorphogenesis Biological Process

GO:0010268 brassinosteroid homeostasis Biological Process

GO:0016125 sterol metabolic process Biological Process

GO:0016132 brassinosteroid biosynthetic process Biological Process

GO:0018343 protein farnesylation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0016020 membrane Cellular Component

GO:0004497 monooxygenase activity Molecular Function

GO:0005506 iron ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G30180

bdi:100837653

sly:100037489

sly:100136888

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.906

Rank 1 · LXL04_024197 · OH-1004

Cytoplasm0.046

Rank 2 · LXL04_024197 · OH-1004

Cell membrane0.035

Rank 3 · LXL04_024197 · OH-1004

Nucleus0.031

Rank 4 · LXL04_024197 · OH-1004

Mitochondrion0.029

Rank 5 · LXL04_024197 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067.28p45035-448 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024197	`PF00067.28`	p450	35	448	2.6e-57	195.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q940V4`	Arabidopsis thaliana	Cytochrome P450 85A2	68.683%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card