Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1883 bp · TkA06G165450|TK1151|cDNA
GCAAAACACTTCAGCAAAGCAAACCCCTCTTTCCTTCCTCTCTCTCTCTCTCTCGCTCTATACATATATATATATATATCTCTGTATACATCATCTGTTATAGAAGCTTGGAAGAGAGAGCATCCATGGCTTTTTCACAGTTATTATTGGTGTTGTATTGGGACTTTGCCTCTTAAGCACTGCCCTTTTGAGATGGAATGAGATGAAGTACAAGAAGAAAGGCCTACCTCCTGGTACCATGGGTTGGCCACTTTTTGGTG...
1323 bp · TkA06G165450|TK1151|CDS
ATGAAGTACAAGAAGAAAGGCCTACCTCCTGGTACCATGGGTTGGCCACTTTTTGGTGAGACCACCGATTTCCTCAAACAAGGCCCCAGCTTCATGAAAAACCAGAGAGCAAGATATGGCAGTGTGTTCAAATCTCATATCTTGGGATGCCCGACAATCGTTTCAATGGATCCACAGCTTAATAAATTCATACTCATGAATGAAGGCAAAGGAATCCTTCCAGGATACCCACAATCCATGCTTGATATTTTGGGCAAATC...
Protein
Download Protein FASTA440 aa · TkA06G165450|TK1151|PROTEIN
MKYKKKGLPPGTMGWPLFGETTDFLKQGPSFMKNQRARYGSVFKSHILGCPTIVSMDPQLNKFILMNEGKGILPGYPQSMLDILGKSNIAAVHGPAHKNMRGALLSLVSPTMIREQILPKIDDFIRSHLLNWNNQIVDIQEKTKEMALLSSIKQIFGAETCSLSKEFMPEFFKLVLGTLSLPINLPNTNYHRGLQARKNIVRMLGELIDERRGSEETHHDMLSQLMSGVDNRYKLSDEEIIDQIITILYSGYETVSTTSM...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA06G165450 |
|---|---|
| TK1151 ID | TkA06G165450 |
| OH-1004 ID | LXL04_024197 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.800 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 94.421Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA06G165450 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr06:43593379-43597165 (-) | |||||||||
| Description | Similar to CYP85A1: Cytochrome P450 85A1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0001578 microtubule bundle formation Biological Process GO:0009416 response to light stimulus Biological Process GO:0009647 skotomorphogenesis Biological Process GO:0010268 brassinosteroid homeostasis Biological Process GO:0016125 sterol metabolic process Biological Process GO:0016132 brassinosteroid biosynthetic process Biological Process GO:0018343 protein farnesylation Biological Process GO:0005739 mitochondrion Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0016020 membrane Cellular Component GO:0004497 monooxygenase activity Molecular Function GO:0005506 iron ion binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT3G30180 bdi:100837653 sly:100037489 sly:100136888 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00067p4509-422 aaPF03801Ndc80_HEC81-110 aaPF03801Ndc80_HEC220-274 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA06G165450 | PF00067 | p450 | 9 | 422 | 1.1e-56 | 193.2 |
| TkA06G165450 | PF03801 | Ndc80_HEC | 81 | 110 | 0.17 | 12.5 |
| TkA06G165450 | PF03801 | Ndc80_HEC | 220 | 274 | 0.17 | 12.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.