LXL04_023077 | RubberDandelionOmics

Gene overview

LXL04_023077

Reference: OH-1004 Chr: Chr05 Coordinates: 22470902-22474450 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

975 bp · LXL04_023077|LXL04_023077|OH1004|cDNA

ATGGGTCGCAATAAGCTTCCAATGAAAAGAATCGAGAACAACACAAGCAGATTGGTCACATTTTGCAAACGTAGAAATGGACTCATTAAGAAGGCTTACGAGCTCTCGGTTTTATGTGATATTGACATCGCTCTCATCATGTTTTCTCCCTCAGGCCGCCTTAACCACTTCTCCTGTAAACGAAGAACAGAAGACGTACTCAATCGATTCGTAAATCTCTCTGACTCTGATAGAGGAAGTGTGATTCAACATAGAGAGTA...

CDS

Download CDS FASTA

975 bp · LXL04_023077|LXL04_023077|OH1004|CDS

ATGGGTCGCAATAAGCTTCCAATGAAAAGAATCGAGAACAACACAAGCAGATTGGTCACATTTTGCAAACGTAGAAATGGACTCATTAAGAAGGCTTACGAGCTCTCGGTTTTATGTGATATTGACATCGCTCTCATCATGTTTTCTCCCTCAGGCCGCCTTAACCACTTCTCCTGTAAACGAAGAACAGAAGACGTACTCAATCGATTCGTAAATCTCTCTGACTCTGATAGAGGAAGTGTGATTCAACATAGAGAGTA...

Protein

Download Protein FASTA

324 aa · LXL04_023077|LXL04_023077|OH1004|PROTEIN

MGRNKLPMKRIENNTSRLVTFCKRRNGLIKKAYELSVLCDIDIALIMFSPSGRLNHFSCKRRTEDVLNRFVNLSDSDRGSVIQHREYLNSLLSKIRNENDLAIHIPCPGAIDVQSEEIHQEISTLQHQIHMAKEQLRIYEPDPTTFTSLYDYESYEKLLYKTLDQVTQRKEYLLSNQPPAYDSRVLQQGESSSKNEELNCWRENVCDGTNRINEQTHPNMFTASSPENTYEATRNQLSNAIFDPLPKSTMNEEPQSIEAF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023077`
TK1151 ID	TkA06G405100
OH-1004 ID	LXL04_023077
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023077

Location Chr05:22470902-22474450 (+)

Description Similar to AGL104: Agamous-like MADS-box protein AGL104

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g22130`	Probable transcription factor that forms heterodimers with the MADS-box proteins AGL30 and AGL65 and is involved in the regulation of pollen maturation at the late stages of pollen development and pollen tube growth.	MIKC* MADS domain heterodimers are required for pollen maturation and tube growth in Arabidopsis.2009 · DOI: 10.1104/pp.109.135806
`At1g77980`	Probable transcription factor that forms a heterodimer with the MADS-box protein AGL30 and is involved in the regulation of pollen maturation at the late stages of pollen development and pollen tube growth.	MIKC* MADS domain heterodimers are required for pollen maturation and tube growth in Arabidopsis.2009 · DOI: 10.1104/pp.109.135806

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0886200`	Probable transcription factor.	No verified direct reference in this release
`Os12g0207000`	Probable transcription factor.	No verified direct reference in this release
`Os01g0201700`	Probable transcription factor involved in the development of floral organs.	Ectopic expression of OsMADS3, a rice ortholog of AGAMOUS, caused a homeotic transformation of lodicules to stamens in transgenic rice plants.2002 · DOI: 10.1093/pcp/pcf010 Functional diversification of the two C-class MADS box genes OSMADS3 and OSMADS58 in Oryza sativa.2006 · DOI: 10.1105/tpc.105.037200 Identification of class B and class C floral organ identity genes from rice plants.1998 · DOI: 10.1023/a:1006051911291

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023077 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009555 pollen development Biological Process

GO:0010097 specification of stamen identity Biological Process

GO:0010152 pollen maturation Biological Process

GO:0010622 specification of ovule identity Biological Process

GO:0030154 cell differentiation Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0048283 indeterminate inflorescence morphogenesis Biological Process

GO:0048481 plant ovule development Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

KEGG gene cross-reference

ath:AT1G22130

ath:AT1G77980

dosa:Os12g0207000

osa:4351753

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.969

Rank 1 · LXL04_023077 · OH-1004

Cytoplasm0.108

Rank 2 · LXL04_023077 · OH-1004

Cell membrane0.021

Rank 3 · LXL04_023077 · OH-1004

Endoplasmic reticulum0.013

Rank 4 · LXL04_023077 · OH-1004

Plastid0.010

Rank 5 · LXL04_023077 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00319.24SRF-TF10-57 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023077	`PF00319.24`	SRF-TF	10	57	3.6e-24	84.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LM46`	Arabidopsis thaliana	Agamous-like MADS-box protein AGL104	46.693%	Swiss-Prot	moderate database homology
`Q1PFC2`	Arabidopsis thaliana	Agamous-like MADS-box protein AGL66	46.914%	Swiss-Prot	moderate database homology
`Q8RU31`	Oryza sativa subsp. japonica	MADS-box transcription factor 21	50.000%	Swiss-Prot	weak database homology
`Q2QW53`	Oryza sativa subsp. japonica	MADS-box transcription factor 13	35.000%	Swiss-Prot	moderate database homology
`Q40704`	Oryza sativa subsp. japonica	MADS-box transcription factor 3	36.158%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card