TkA06G405100 | RubberDandelionOmics

Gene overview

TkA06G405100

Reference: TK1151 Chr: Chr06 Coordinates: 100336453-100340385 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1323 bp · TkA06G405100|TK1151|cDNA

CACATTTTCTTCATTCCTTTTCTTTCTCTCTCGGATCCTCCTCCGTTGCAGGTCCTGACATCATCATCTTCTTCCCCATCTTTCTAAAACTGGAATTTCAACAGAACAAAAAGCAATCTAATTTCTGTATTTAGAAAAATTACTTTCTATTGTTATATCTTTCTCGAAATAGAAAGAGAAAGTTCCATGTATATAATTAGAAATGGGTCGCAATAAGCTTCCAATGAAAAGAATCGAGAACAACACAAGCAGATTGGTCA...

CDS

Download CDS FASTA

972 bp · TkA06G405100|TK1151|CDS

ATGGGTCGCAATAAGCTTCCAATGAAAAGAATCGAGAACAACACAAGCAGATTGGTCACATTTTGCAAACGTAGAAATGGACTCATTAAGAAGGCTTATGAGCTCTCGGTTTTATGTGATATTGACATCGCTCTCATCATGTTTTCTCCCTCAGGCCGCCTTAACCACTTCTCCTGTAAACGAAGAACAGAAGATGTACTCAATCGATTCGTAAATCTCTCTGACTCTGATAGAGGAAGTGTGATTCAACATAGAGAGTA...

Protein

Download Protein FASTA

323 aa · TkA06G405100|TK1151|PROTEIN

MGRNKLPMKRIENNTSRLVTFCKRRNGLIKKAYELSVLCDIDIALIMFSPSGRLNHFSCKRRTEDVLNRFVNLSDSDRGSVIQHREYLNSLLSKIRNENDLAIHIPCPGAIDVQSEEIHQEISTLQHQIHMAKEQLRIFEPDPTTFTSLYDYESYEKLLYKTLDQVTQRKEYLLSNQPPAYDSRVLQGESSSKNEELNCWRENVCDGTNRINEQTHPNMFTASSPENTYEATRNQLSNAIFDPLPKSTMNEEPQSIEAFQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G405100`
TK1151 ID	TkA06G405100
OH-1004 ID	LXL04_023077
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G405100

Location Chr06:100336453-100340385 (-)

Description Similar to AGL104: Agamous-like MADS-box protein AGL104

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g22130`	Probable transcription factor that forms heterodimers with the MADS-box proteins AGL30 and AGL65 and is involved in the regulation of pollen maturation at the late stages of pollen development and pollen tube growth.	MIKC* MADS domain heterodimers are required for pollen maturation and tube growth in Arabidopsis.2009 · DOI: 10.1104/pp.109.135806
`At1g77980`	Probable transcription factor that forms a heterodimer with the MADS-box protein AGL30 and is involved in the regulation of pollen maturation at the late stages of pollen development and pollen tube growth.	MIKC* MADS domain heterodimers are required for pollen maturation and tube growth in Arabidopsis.2009 · DOI: 10.1104/pp.109.135806

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0886200`	Probable transcription factor.	No verified direct reference in this release
`Os12g0207000`	Probable transcription factor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023077 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009555 pollen development Biological Process

GO:0010097 specification of stamen identity Biological Process

GO:0010152 pollen maturation Biological Process

GO:0010622 specification of ovule identity Biological Process

GO:0030154 cell differentiation Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0048283 indeterminate inflorescence morphogenesis Biological Process

GO:0048481 plant ovule development Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

KEGG gene cross-reference

ath:AT1G22130

ath:AT1G77980

dosa:Os12g0207000

osa:4351753

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.969

Rank 1 · TkA06G405100 · TK1151

Cytoplasm0.107

Rank 2 · TkA06G405100 · TK1151

Cell membrane0.021

Rank 3 · TkA06G405100 · TK1151

Endoplasmic reticulum0.013

Rank 4 · TkA06G405100 · TK1151

Plastid0.010

Rank 5 · TkA06G405100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00319SRF-TF10-57 aa

PF01486K-box114-177 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G405100	`PF00319`	SRF-TF	10	57	3.5e-24	84.7
TkA06G405100	`PF01486`	K-box	114	177	0.0054	17.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LM46`	Arabidopsis thaliana	sp\|Q9LM46\|AG104_ARATH Agamous-like MADS-box protein AGL104	41.900%	Swiss-Prot	Medium
`Q1PFC2`	Arabidopsis thaliana	sp\|Q1PFC2\|AGL66_ARATH Agamous-like MADS-box protein AGL66	51.200%	Swiss-Prot	Medium
`Q8RU31`	Oryza sativa subsp. japonica	sp\|Q8RU31\|MAD21_ORYSJ MADS-box transcription factor 21	50.000%	Swiss-Prot	Low
`Q2QW53`	Oryza sativa subsp. japonica	sp\|Q2QW53\|MAD13_ORYSJ MADS-box transcription factor 13	35.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card