LXL04_018177 | RubberDandelionOmics

Gene overview

LXL04_018177

Reference: OH-1004 Chr: Chr04 Coordinates: 8070555-8073001 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1191 bp · LXL04_018177|LXL04_018177|OH1004|cDNA

ATGGCTGAAATGCAAAAGTTCTGTTCTGTTTTTAGATGCAAAGCAAATGATTCATACAAAGGAAGATCAAGCTGCCAAGGAGGCCTGTCGGCTCACGGTTGTCGATGTCTGCAACTCTGCAAGAACGGAGGAAGGAGGAGAAGCCGAGAAGGTCACCTCACTGTGTCATGCGTCTGCAATCACGGACGATGTCTACAAGAACGGAGGAAGGAGGAGAAACCGTGTGCAATGATGAAGATTGAAGGCGTGAAGATGAAGGC...

CDS

Download CDS FASTA

1191 bp · LXL04_018177|LXL04_018177|OH1004|CDS

ATGGCTGAAATGCAAAAGTTCTGTTCTGTTTTTAGATGCAAAGCAAATGATTCATACAAAGGAAGATCAAGCTGCCAAGGAGGCCTGTCGGCTCACGGTTGTCGATGTCTGCAACTCTGCAAGAACGGAGGAAGGAGGAGAAGCCGAGAAGGTCACCTCACTGTGTCATGCGTCTGCAATCACGGACGATGTCTACAAGAACGGAGGAAGGAGGAGAAACCGTGTGCAATGATGAAGATTGAAGGCGTGAAGATGAAGGC...

Protein

Download Protein FASTA

396 aa · LXL04_018177|LXL04_018177|OH1004|PROTEIN

MAEMQKFCSVFRCKANDSYKGRSSCQGGLSAHGCRCLQLCKNGGRRRSREGHLTVSCVCNHGRCLQERRKEEKPCAMMKIEGVKMKAEAENRTLALTSLWEVMGSSPSPGMMHPRVLPSCGVSQEKVGSSLGKNQSGEIKEGGKGGDSRLPGKSGPVSNVPESSVRLLVIVHKTPIKWCLQAFQKPVAYDPSSSSSSSSPTSTSTPTTTEENKEAVVDMMKIKDMANTLDIRVGKILKAWRHEEADSLYVEEVDIGEPEP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018177`
TK1151 ID	TkA08G022230
OH-1004 ID	LXL04_018177
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.400
Protein coverage (%)	TK1151 70.833 / OH-1004 47.222 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018177

Location Chr04:8070555-8073001 (-)

Description Similar to Aimp1: Aminoacyl tRNA synthase complex-interacting multifunctional protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0508700`	Probable methionine--tRNA ligase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018177 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001937 negative regulation of endothelial cell proliferation Biological Process

GO:0006412 translation Biological Process

GO:0006418 tRNA aminoacylation for protein translation Biological Process

GO:0006431 methionyl-tRNA aminoacylation Biological Process

GO:0006437 tyrosyl-tRNA aminoacylation Biological Process

GO:0007267 cell-cell signaling Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0042594 response to starvation Biological Process

GO:0048608 reproductive structure development Biological Process

GO:0051607 defense response to virus Biological Process

GO:0070094 positive regulation of glucagon secretion Biological Process

GO:0005615 extracellular space Cellular Component

KEGG gene cross-reference

cge:100689238

hsa:9255

mmu:13722

rno:313047

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.732

Rank 1 · LXL04_018177 · OH-1004

Mitochondrion0.277

Rank 2 · LXL04_018177 · OH-1004

Nucleus0.060

Rank 3 · LXL04_018177 · OH-1004

Cytoplasm0.048

Rank 4 · LXL04_018177 · OH-1004

Cell membrane0.020

Rank 5 · LXL04_018177 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01588.27tRNA_bind231-326 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018177	`PF01588.27`	tRNA_bind	231	326	2.6e-31	108.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZTS1`	Oryza sativa subsp. japonica	Probable methionine--tRNA ligase	47.849%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card