LXL04_011551 | RubberDandelionOmics

Gene overview

LXL04_011551

Reference: OH-1004 Chr: Chr02 Coordinates: 167139090-167140710 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

705 bp · LXL04_011551|LXL04_011551|OH1004|cDNA

ATGAAGCTCAAACAATTAGAAAGTCTACTCGGCAATCTTCAACAATTCGACAATCCCAAGATTGAGCTGGAACAGTATCCAACTGGAGCTCATATTGCTTCTCGTATGCTCTACACGGCAGAGAATTCATATGGGGACGTGAGCGACAAAGTAGTAGCAGACTTTGGATGTGGGTGTGGTACCTTAGGTCTTGCCGCCACTCTCCTGGATGCAGAACATGTAATTGGCGTTGATGTTGATGACGACTCCCTTGAAATTGC...

CDS

Download CDS FASTA

705 bp · LXL04_011551|LXL04_011551|OH1004|CDS

ATGAAGCTCAAACAATTAGAAAGTCTACTCGGCAATCTTCAACAATTCGACAATCCCAAGATTGAGCTGGAACAGTATCCAACTGGAGCTCATATTGCTTCTCGTATGCTCTACACGGCAGAGAATTCATATGGGGACGTGAGCGACAAAGTAGTAGCAGACTTTGGATGTGGGTGTGGTACCTTAGGTCTTGCCGCCACTCTCCTGGATGCAGAACATGTAATTGGCGTTGATGTTGATGACGACTCCCTTGAAATTGC...

Protein

Download Protein FASTA

234 aa · LXL04_011551|LXL04_011551|OH1004|PROTEIN

MKLKQLESLLGNLQQFDNPKIELEQYPTGAHIASRMLYTAENSYGDVSDKVVADFGCGCGTLGLAATLLDAEHVIGVDVDDDSLEIASINADDLEVEMGLIQCQINNLNWRGQIVDTVVMNPPFGTRKKGADMEFLSVALKVASQAVYSLHKTTTREHIKRAALRDYNASSAEVICEVHILIHILLLYHNFDMICQNYTNFTRKKTLILLWTYGDLFLNQNNNLLHEKDIDVDF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011551`
TK1151 ID	TkA03G601230
OH-1004 ID	LXL04_011551
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.700
Protein coverage (%)	TK1151 88.732 / OH-1004 80.769 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_011551`
Location	Chr02:167139090-167140710 (-)
Description	Similar to Mettl5: rRNA N6-adenosine-methyltransferase METTL5
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_011551` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006364 rRNA processing Biological Process GO:0031167 rRNA methylation Biological Process GO:0032056 positive regulation of translation in response to stress Biological Process GO:0045727 positive regulation of translation Biological Process GO:0048863 stem cell differentiation Biological Process GO:0070475 rRNA base methylation Biological Process GO:0001650 fibrillar center Cellular Component GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0036396 RNA N6-methyladenosine methyltransferase complex Cellular Component
KEGG gene cross-reference	cel:CELE_C38D4.9 dme:Dmel_CG9666 dre:449776 hsa:29081 mmu:75422 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.547

Rank 1 · LXL04_011551 · OH-1004

Nucleus0.353

Rank 2 · LXL04_011551 · OH-1004

Mitochondrion0.144

Rank 3 · LXL04_011551 · OH-1004

Plastid0.065

Rank 4 · LXL04_011551 · OH-1004

Peroxisome0.053

Rank 5 · LXL04_011551 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06325.20PrmA28-121 aa

PF05175.21MTS48-131 aa

PF13847.13Methyltransf_3148-124 aa

PF13649.13Methyltransf_2552-121 aa

PF01170.25UPF002071-130 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011551	`PF06325.20`	PrmA	28	121	2.2e-11	44.6
LXL04_011551	`PF05175.21`	MTS	48	131	1.7e-11	44.7
LXL04_011551	`PF13847.13`	Methyltransf_31	48	124	9.7e-09	35.9
LXL04_011551	`PF13649.13`	Methyltransf_25	52	121	7.2e-08	33.7
LXL04_011551	`PF01170.25`	UPF0020	71	130	9.1e-06	26.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card