TkA03G601230 | RubberDandelionOmics

Gene overview

TkA03G601230

Reference: TK1151 Chr: Chr03 Coordinates: 152670036-152672020 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1047 bp · TkA03G601230|TK1151|cDNA

TTTGATTATTATTATTAGGGTTCTTGCTTATACGTTCTTTTTTCCCTTTTACATACTGAGCGAGAATCATCCATACACCTGAAAGGGATGAAGCTCAAACAATTAGAAAGTCTACTCGGCAATCTTCAACAATTCGACAATCCCAAGATTGAGCTGGAACAGTATCCAACTGGAGCTCATATTGCTTCTCGTATGCTCTACACGGCAGAGAATTCATATGGGGACGTGAGCGACAAAGTAGTAGCAGACTTTGGATGTGG...

CDS

Download CDS FASTA

642 bp · TkA03G601230|TK1151|CDS

ATGAAGCTCAAACAATTAGAAAGTCTACTCGGCAATCTTCAACAATTCGACAATCCCAAGATTGAGCTGGAACAGTATCCAACTGGAGCTCATATTGCTTCTCGTATGCTCTACACGGCAGAGAATTCATATGGGGACGTGAGCGACAAAGTAGTAGCAGACTTTGGATGTGGGTGTGGTACCTTAGGTCTTGCCGCCACTCTCCTGGATGCAGAACATGTAATTGGCGTTGATGTTGATGACGACTCCCTTGAAATTGC...

Protein

Download Protein FASTA

213 aa · TkA03G601230|TK1151|PROTEIN

MKLKQLESLLGNLQQFDNPKIELEQYPTGAHIASRMLYTAENSYGDVSDKVVADFGCGCGTLGLAATLLDAEHVIGVDVDDDSLEIASINADDLEVEMGLIQCQINNLNWRGQIVDTVVMNPPFGTRKKGADMEFLSVALKVASQAVYSLHKTTTREHIKRAALRDYNASSAEVICELRYDLPKLYKFHKKKDVDIAVDLWRFVPKSNQESSS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G601230`
TK1151 ID	TkA03G601230
OH-1004 ID	LXL04_011551
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.700
Protein coverage (%)	TK1151 88.732 / OH-1004 80.769 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G601230`
Location	Chr03:152670036-152672020 (-)
Description	Similar to Mettl5: rRNA N6-adenosine-methyltransferase METTL5
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_011551` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006364 rRNA processing Biological Process GO:0031167 rRNA methylation Biological Process GO:0032056 positive regulation of translation in response to stress Biological Process GO:0045727 positive regulation of translation Biological Process GO:0048863 stem cell differentiation Biological Process GO:0070475 rRNA base methylation Biological Process GO:0001650 fibrillar center Cellular Component GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0036396 RNA N6-methyladenosine methyltransferase complex Cellular Component
KEGG gene cross-reference	cel:CELE_C38D4.9 dme:Dmel_CG9666 dre:449776 hsa:29081 mmu:75422 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.549

Rank 1 · TkA03G601230 · TK1151

Cytoplasm0.474

Rank 2 · TkA03G601230 · TK1151

Mitochondrion0.117

Rank 3 · TkA03G601230 · TK1151

Plastid0.028

Rank 4 · TkA03G601230 · TK1151

Cell membrane0.023

Rank 5 · TkA03G601230 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06325PrmA28-121 aa

PF03602Cons_hypoth9542-147 aa

PF10294Methyltransf_1644-119 aa

PF13679Methyltransf_3244-109 aa

PF05175MTS48-131 aa

PF13847Methyltransf_3148-124 aa

PF01555N6_N4_Mtase49-87 aa

PF08123DOT149-107 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G601230	`PF06325`	PrmA	28	121	1.7e-11	44.9
TkA03G601230	`PF03602`	Cons_hypoth95	42	147	0.00019	21.9
TkA03G601230	`PF10294`	Methyltransf_16	44	119	0.0073	16.8
TkA03G601230	`PF13679`	Methyltransf_32	44	109	0.013	16.2
TkA03G601230	`PF05175`	MTS	48	131	1.4e-11	45.0
TkA03G601230	`PF13847`	Methyltransf_31	48	124	8.8e-09	36.0
TkA03G601230	`PF01555`	N6_N4_Mtase	49	87	0.018	15.7
TkA03G601230	`PF08123`	DOT1	49	107	0.081	13.2
TkA03G601230	`PF09445`	Methyltransf_15	51	129	0.011	16.1
TkA03G601230	`PF13649`	Methyltransf_25	52	121	6.4e-08	33.9
TkA03G601230	`PF07021`	MetW	52	149	0.099	13.0
TkA03G601230	`PF08241`	Methyltransf_11	54	121	0.00028	22.2
TkA03G601230	`PF29244`	Methyltransf_ANTKMT	54	97	0.0013	19.9
TkA03G601230	`PF08242`	Methyltransf_12	54	120	0.022	16.2
TkA03G601230	`PF19669`	DUF6172	54	75	0.37	11.6
TkA03G601230	`PF01170`	UPF0020	70	130	6.5e-06	26.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card