LXL04_011122 | RubberDandelionOmics

Gene overview

LXL04_011122

Reference: OH-1004 Chr: Chr02 Coordinates: 158314094-158324886 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5319 bp · LXL04_011122|LXL04_011122|OH1004|cDNA

ATGGAACGGAGGGACTACAATCGCGATGGCTACAGCCGTGGCCGTGGCCGTGTCGATCGGTACTATGTAGACGCACGGGATGGTGATAGAGGCGGATATGGCGACGACCGGCACTATGGGGGCGGCGCACAAGACAGTGAAAGAGGCGGATATGGCGGCGACCGGTACTATGGGGGCGGCGCACAAGACAGTGAAAGGGGTGGATATGGCGGCGACCGGTACTTTGGGGGTTCACAAGACGTTGAAAGGGGCGGATATGG...

CDS

Download CDS FASTA

5319 bp · LXL04_011122|LXL04_011122|OH1004|CDS

ATGGAACGGAGGGACTACAATCGCGATGGCTACAGCCGTGGCCGTGGCCGTGTCGATCGGTACTATGTAGACGCACGGGATGGTGATAGAGGCGGATATGGCGACGACCGGCACTATGGGGGCGGCGCACAAGACAGTGAAAGAGGCGGATATGGCGGCGACCGGTACTATGGGGGCGGCGCACAAGACAGTGAAAGGGGTGGATATGGCGGCGACCGGTACTTTGGGGGTTCACAAGACGTTGAAAGGGGCGGATATGG...

Protein

Download Protein FASTA

1772 aa · LXL04_011122|LXL04_011122|OH1004|PROTEIN

MERRDYNRDGYSRGRGRVDRYYVDARDGDRGGYGDDRHYGGGAQDSERGGYGGDRYYGGGAQDSERGGYGGDRYFGGSQDVERGGYGGDRYSGGAQIGERGGYGGDRYSGGAQIGERGGYGGDRYYDGRAGYVGDRYYEEAQDDGRGGFSGETGAGYHPRGGGRDRNYPHPYNDRHQEQYGGSRRRESGSGGGRSQQYRTPPTYHRHSTDRVQNRSGREREARRSPVEYGQSVKSRSRSRSPFPPPPPPRSRSPFPSQPP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011122`
TK1151 ID	TkA03G566830
OH-1004 ID	LXL04_011122
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 82.232 / OH-1004 54.063 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011122

Location Chr02:158314094-158324886 (-)

Description Similar to AGO2: Protein argonaute 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g31280`	Involved in RNA-mediated post-transcriptional gene silencing (PTGS).	Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5' terminal nucleotide.2008 · DOI: 10.1016/j.cell.2008.02.034 The mechanism selecting the guide strand from small RNA duplexes is different among argonaute proteins.2008 · DOI: 10.1093/pcp/pcn043 NERD, a plant-specific GW protein, defines an additional RNAi-dependent chromatin-based pathway in Arabidopsis.2012 · DOI: 10.1016/j.molcel.2012.07.027 RH3 enhances antiviral defense by facilitating small RNA loading into Argonaute 2 at endoplasmic reticulum-chloroplast membrane contact sites.2025 · DOI: 10.1038/s41467-025-57296-6
`At1g31290`	Involved in RNA-mediated post-transcriptional gene silencing (PTGS).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0615700`	Probably involved in the RNA silencing pathway.	No verified direct reference in this release
`Os04g0615800`	Probably involved in the RNA silencing pathway.	No verified direct reference in this release
`Os03g0449200`	Involved in the RNA silencing pathway.	Over-expression of rice OsAGO7 gene induces upward curling of the leaf blade that enhanced erect-leaf habit.2007 · DOI: 10.1007/s00425-006-0472-0 The small interfering RNA production pathway is required for shoot meristem initiation in rice.2007 · DOI: 10.1073/pnas.0704339104

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011122 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006417 regulation of translation Biological Process

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

GO:0035195 miRNA-mediated post-transcriptional gene silencing Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0051607 defense response to virus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

KEGG gene cross-reference

ath:AT1G31280

ath:AT1G31290

dosa:Os04g0615700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.741

Rank 1 · LXL04_011122 · OH-1004

Nucleus0.313

Rank 2 · LXL04_011122 · OH-1004

Cell membrane0.076

Rank 3 · LXL04_011122 · OH-1004

Mitochondrion0.070

Rank 4 · LXL04_011122 · OH-1004

Endoplasmic reticulum0.052

Rank 5 · LXL04_011122 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16486.12ArgoN307-439 aa

PF08699.16ArgoL1460-499 aa

PF02170.29PAZ505-632 aa

PF16488.11ArgoL2646-693 aa

PF16486.12ArgoN944-1076 aa

PF08699.16ArgoL11087-1136 aa

PF02170.29PAZ1157-1265 aa

PF16488.11ArgoL21283-1330 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011122	`PF16486.12`	ArgoN	307	439	6.1e-48	163.6
LXL04_011122	`PF08699.16`	ArgoL1	460	499	2.5e-16	59.8
LXL04_011122	`PF02170.29`	PAZ	505	632	1.9e-48	164.2
LXL04_011122	`PF16488.11`	ArgoL2	646	693	4.4e-18	65.9
LXL04_011122	`PF16486.12`	ArgoN	944	1076	6.1e-48	163.6
LXL04_011122	`PF08699.16`	ArgoL1	1087	1136	2.5e-16	59.8
LXL04_011122	`PF02170.29`	PAZ	1157	1265	1.9e-48	164.2
LXL04_011122	`PF16488.11`	ArgoL2	1283	1330	4.4e-18	65.9
LXL04_011122	`PF16487.11`	ArgoMid	1349	1426	7.8e-07	30.0
LXL04_011122	`PF02171.24`	Piwi	1442	1734	8.5e-92	308.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SHF3`	Arabidopsis thaliana	Protein argonaute 2	43.584%	Swiss-Prot	moderate database homology
`Q9SHF2`	Arabidopsis thaliana	Protein argonaute 3	45.006%	Swiss-Prot	weak database homology
`Q7XTS4`	Oryza sativa subsp. japonica	Protein argonaute 2	41.769%	Swiss-Prot	weak database homology
`Q7XTS3`	Oryza sativa subsp. japonica	Protein argonaute 3	40.252%	Swiss-Prot	weak database homology
`Q75HC2`	Oryza sativa subsp. japonica	Protein argonaute 7	37.703%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card