LXL04_039832 | RubberDandelionOmics

Gene overview

LXL04_039832

Reference: OH-1004 Chr: JAJTUU010000050.1 Coordinates: 184820-187239 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

807 bp · LXL04_039832|LXL04_039832|OH1004|cDNA

ATGTTGTTTGATTATAAAGGAAGGCGATGTTCATATCACCCGATGTTTGGAACGGAACACATATCAATTCCAGGAACTCAATTTCCTCTCCCAACCGAAGGTGTCGATGAAACAAGGAAAACTTCTACAGAACGAGACCTATCCGATTTCTTTTCCCTTCGTGATCCAGATATAGTTTCATTTGTTGAGCTGTGTCAGAAGTTAGATTTGCTGGTCATGCTATGGGTTGGGCCATACATATGTGCAGAATGGGATTTTGG...

CDS

Download CDS FASTA

807 bp · LXL04_039832|LXL04_039832|OH1004|CDS

ATGTTGTTTGATTATAAAGGAAGGCGATGTTCATATCACCCGATGTTTGGAACGGAACACATATCAATTCCAGGAACTCAATTTCCTCTCCCAACCGAAGGTGTCGATGAAACAAGGAAAACTTCTACAGAACGAGACCTATCCGATTTCTTTTCCCTTCGTGATCCAGATATAGTTTCATTTGTTGAGCTGTGTCAGAAGTTAGATTTGCTGGTCATGCTATGGGTTGGGCCATACATATGTGCAGAATGGGATTTTGG...

Protein

Download Protein FASTA

268 aa · LXL04_039832|LXL04_039832|OH1004|PROTEIN

MLFDYKGRRCSYHPMFGTEHISIPGTQFPLPTEGVDETRKTSTERDLSDFFSLRDPDIVSFVELCQKLDLLVMLWVGPYICAEWDFGGFPAWLLTKEPSIRLRSSDPVYLTLVDKWWGTLFPKISHLLYHKGGPIVMLQIENEFGSYGVDKNYMHHLVNLARSHLGDDLILYTTDGGNRDTLTKGTINGDAVFSASALENILSRNGSAVLYMAHGGTNFGFYNGANAQESESNYLADLTSYDYDAPISESGDVDGAKFKA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039832`
TK1151 ID	TkA04G314330
OH-1004 ID	LXL04_039832
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 80.392 / OH-1004 45.896 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039832

Location JAJTUU010000050.1:184820-187239 (+)

Description Similar to BGAL17: Beta-galactosidase 17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g72990`	Beta-galactosidase 17.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0539400`	Beta-galactosidase 8.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039832 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006516 glycoprotein catabolic process Biological Process

GO:0006689 ganglioside catabolic process Biological Process

GO:0019388 galactose catabolic process Biological Process

GO:0042340 keratan sulfate proteoglycan catabolic process Biological Process

GO:0051413 response to cortisone Biological Process

GO:1904016 response to Thyroglobulin triiodothyronine Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005615 extracellular space Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005764 lysosome Cellular Component

GO:0005773 vacuole Cellular Component

KEGG gene cross-reference

ath:AT1G72990

dosa:Os05g0539400

hsa:2720

mmu:12091

pon:100173272

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.385

Rank 1 · LXL04_039832 · OH-1004

Nucleus0.189

Rank 2 · LXL04_039832 · OH-1004

Peroxisome0.148

Rank 3 · LXL04_039832 · OH-1004

Extracellular0.129

Rank 4 · LXL04_039832 · OH-1004

Endoplasmic reticulum0.121

Rank 5 · LXL04_039832 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01301.26Glyco_hydro_3556-194 aa

PF01301.26Glyco_hydro_35195-267 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039832	`PF01301.26`	Glyco_hydro_35	56	194	2.2e-66	225.4
LXL04_039832	`PF01301.26`	Glyco_hydro_35	195	267	2.2e-66	225.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93Z24`	Arabidopsis thaliana	Beta-galactosidase 17	53.788%	Swiss-Prot	strong database homology
`Q0DGD7`	Oryza sativa subsp. japonica	Beta-galactosidase 8	55.303%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card