Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1023 bp · LXL04_038491|LXL04_038491|OH1004|cDNA
ATGGCGGCGGTGCCACCAGTCACCGGCATGGAGCTAAACAGTCCTCCCTCCGACGGCATATCCAACCTCCGCTTCTCTCACCACTCTGATCATCTCCTCGTCTCTTCCTGGGACAAACGTGTGCGCCTATACGATGCAAGTGCCAATGTGTTAAGAGGAGAGTTTCTACACGGAGGTGCAGTCCTTGATTGCTGCTTCCATGACGACACCTCTGGTTTTAGTGCTAGTGCTGATAACACTGTCACAAGGCTTGTTTTTGA...
1023 bp · LXL04_038491|LXL04_038491|OH1004|CDS
ATGGCGGCGGTGCCACCAGTCACCGGCATGGAGCTAAACAGTCCTCCCTCCGACGGCATATCCAACCTCCGCTTCTCTCACCACTCTGATCATCTCCTCGTCTCTTCCTGGGACAAACGTGTGCGCCTATACGATGCAAGTGCCAATGTGTTAAGAGGAGAGTTTCTACACGGAGGTGCAGTCCTTGATTGCTGCTTCCATGACGACACCTCTGGTTTTAGTGCTAGTGCTGATAACACTGTCACAAGGCTTGTTTTTGA...
Protein
Download Protein FASTA340 aa · LXL04_038491|LXL04_038491|OH1004|PROTEIN
MAAVPPVTGMELNSPPSDGISNLRFSHHSDHLLVSSWDKRVRLYDASANVLRGEFLHGGAVLDCCFHDDTSGFSASADNTVTRLVFDNEREDVLGRHDAPVRCIEYSYATGQVITGSWDKTLKCWDPRGGGAQERALVGTYGQPERVYSISLVGNRVVVATAGRHVNVYDLRNMSQPEQRRESSLKYQTRCVQCYPNGTGYALSSVEGRVAMEFFELTESGQAKKYAFKCHRKSEAGRDIVYPVNAIAFHPVYGTFATGG...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_038491 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_038491 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr09:42424681-42426977 (-) | |||||||||
| Description | Similar to BUB3.1: Mitotic checkpoint protein BUB3.1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0007059 chromosome segregation Biological Process GO:0007094 mitotic spindle assembly checkpoint signaling Biological Process GO:0008608 attachment of spindle microtubules to kinetochore Biological Process GO:0034501 protein localization to kinetochore Biological Process GO:0051301 cell division Biological Process GO:0051321 meiotic cell cycle Biological Process GO:0051983 regulation of chromosome segregation Biological Process GO:0000776 kinetochore Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005819 spindle Cellular Component GO:0005828 kinetochore microtubule Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G49910 ath:AT3G19590 bta:539594 hsa:9184 mmu:12237 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF24807.2WD40_CDC20-Fz16-128 aaPF00400.39WD4017-45 aaPF24817.2WD40_WDHD1_1st17-126 aaPF25175.2Beta-prop_WDR518-227 aaPF23381.2Beta-prop_IFT122_1st19-126 aaPF25173.2Beta-prop_WDR3_1st19-171 aaPF25174.2Beta-prop_THOC374-303 aaPF24814.2WD40_Prp1990-212 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_038491 | PF24807.2 | WD40_CDC20-Fz | 16 | 128 | 9.8e-13 | 48.8 |
| LXL04_038491 | PF00400.39 | WD40 | 17 | 45 | 7e-26 | 90.3 |
| LXL04_038491 | PF24817.2 | WD40_WDHD1_1st | 17 | 126 | 1.2e-17 | 64.7 |
| LXL04_038491 | PF25175.2 | Beta-prop_WDR5 | 18 | 227 | 3.3e-22 | 79.8 |
| LXL04_038491 | PF23381.2 | Beta-prop_IFT122_1st | 19 | 126 | 1.1e-24 | 88.0 |
| LXL04_038491 | PF25173.2 | Beta-prop_WDR3_1st | 19 | 171 | 1.2e-18 | 68.2 |
| LXL04_038491 | PF25174.2 | Beta-prop_THOC3 | 74 | 303 | 7.5e-28 | 98.0 |
| LXL04_038491 | PF24814.2 | WD40_Prp19 | 90 | 212 | 7.3e-18 | 65.3 |
| LXL04_038491 | PF00400.39 | WD40 | 93 | 126 | 7e-26 | 90.3 |
| LXL04_038491 | PF23414.2 | Beta-prop_EML_2 | 110 | 221 | 1.2e-17 | 64.9 |
| LXL04_038491 | PF24817.2 | WD40_WDHD1_1st | 145 | 285 | 1.2e-17 | 64.7 |
| LXL04_038491 | PF24807.2 | WD40_CDC20-Fz | 153 | 294 | 9.8e-13 | 48.8 |
| LXL04_038491 | PF25173.2 | Beta-prop_WDR3_1st | 156 | 302 | 1.2e-18 | 68.2 |
| LXL04_038491 | PF24814.2 | WD40_Prp19 | 242 | 303 | 7.3e-18 | 65.3 |
| LXL04_038491 | PF00400.39 | WD40 | 243 | 269 | 7e-26 | 90.3 |
| LXL04_038491 | PF23381.2 | Beta-prop_IFT122_1st | 243 | 306 | 1.1e-24 | 88.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.