Gene Card
Gene overview
cDNA / CDS / Protein Sequences
330 bp · LXL04_037065|LXL04_037065|OH1004|cDNA
ATGGCAGCAAGGGGATTAGCAGGGGAAGCCTTGATAGCTTACAGAGGACTGCTCAGAGCGACTCGGAAATCATTCGCCGGAGACACCGTGATGCTCGAGGGGTCCGCGGCGGAGGTGAGGAAGAAATTTGAGGAGAACCGTCACGTGACCTCCGAACCGGAGATTCGGAAACTTCTCGACGAGGCACGCGAAGCCTCTGATTTCATATCTAACATGATTGTTCAGGCCAAACTTAACTCCCGCGGCGGCTACGAAGTGAA...
330 bp · LXL04_037065|LXL04_037065|OH1004|CDS
ATGGCAGCAAGGGGATTAGCAGGGGAAGCCTTGATAGCTTACAGAGGACTGCTCAGAGCGACTCGGAAATCATTCGCCGGAGACACCGTGATGCTCGAGGGGTCCGCGGCGGAGGTGAGGAAGAAATTTGAGGAGAACCGTCACGTGACCTCCGAACCGGAGATTCGGAAACTTCTCGACGAGGCACGCGAAGCCTCTGATTTCATATCTAACATGATTGTTCAGGCCAAACTTAACTCCCGCGGCGGCTACGAAGTGAA...
Protein
Download Protein FASTA109 aa · LXL04_037065|LXL04_037065|OH1004|PROTEIN
MAARGLAGEALIAYRGLLRATRKSFAGDTVMLEGSAAEVRKKFEENRHVTSEPEIRKLLDEAREASDFISNMIVQAKLNSRGGYEVKASKDHAGATLEVPSEEILKKSV
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_037065 |
|---|---|
| TK1151 ID | TkA04G007190 |
| OH-1004 ID | LXL04_037065 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_037065 |
|---|---|
| Location | Chr08:52508519-52509625 (+) |
| Description | Similar to MZM1: Mitochondrial zinc maintenance protein 1, mitochondrial (Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0034551 mitochondrial respiratory chain complex III assembly Biological Process GO:0005759 mitochondrial matrix Cellular Component GO:0044183 protein folding chaperone Molecular Function |
| KEGG gene cross-reference | clu:CLUG_04057 ncr:NCU03008 pbl:PAAG_01573 pno:SNOG_08445 val:VDBG_01912 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF05347.22Complex1_LYR9-66 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_037065 | PF05347.22 | Complex1_LYR | 9 | 66 | 3.3e-12 | 46.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.