LXL04_034189 | RubberDandelionOmics

Gene overview

LXL04_034189

Reference: OH-1004 Chr: Chr07 Coordinates: 89442495-89445123 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2106 bp · LXL04_034189|LXL04_034189|OH1004|cDNA

ATGGATTCATATGAAGCAACAAGAGTTGTGTTCACTCGGATTCAGAATTTGGATCCTGAATACGCCTCAAAAATCATGGGTCTTCTCCTAATTCAAGATCATGGCGAGAAAGAGATGATTCGGTTAGCTTTTGGTCCTGAATCACTCGTTCACTCTGTAATTCTCAAAGCTCGCAAAGAACTTGGCATTCCTTCCAGCAACGCGCCGTCGTCACCTTCCACTCCGTCGTCGCCGTCGCCGTTCAGTTCTTCTCACAGTCT...

CDS

Download CDS FASTA

2106 bp · LXL04_034189|LXL04_034189|OH1004|CDS

ATGGATTCATATGAAGCAACAAGAGTTGTGTTCACTCGGATTCAGAATTTGGATCCTGAATACGCCTCAAAAATCATGGGTCTTCTCCTAATTCAAGATCATGGCGAGAAAGAGATGATTCGGTTAGCTTTTGGTCCTGAATCACTCGTTCACTCTGTAATTCTCAAAGCTCGCAAAGAACTTGGCATTCCTTCCAGCAACGCGCCGTCGTCACCTTCCACTCCGTCGTCGCCGTCGCCGTTCAGTTCTTCTCACAGTCT...

Protein

Download Protein FASTA

701 aa · LXL04_034189|LXL04_034189|OH1004|PROTEIN

MDSYEATRVVFTRIQNLDPEYASKIMGLLLIQDHGEKEMIRLAFGPESLVHSVILKARKELGIPSSNAPSSPSTPSSPSPFSSSHSLSRQNSANSSTASRLVNGGVTNLPSPLSIPSLSSSWTNSNFSDFQPTEDHHLNSSAPPFYGGATEPDLIDELQIQDQLSFLNDGSPTLGPKASDFFYPDLVSPNGSSDMYSPWSGSGGPHRRSSSANDICIGGGGEDPNGWKPCLYFARGYCKNGASCRFTHTGGGEADIAAAI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_034189`
TK1151 ID	TkA07G318660
OH-1004 ID	LXL04_034189
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	67.600
Protein coverage (%)	TK1151 96.835 / OH-1004 29.101 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_034189

Location Chr07:89442495-89445123 (+)

Description Similar to Os07g0682400: Zinc finger CCCH domain-containing protein 53

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g51950`	Possesses RNA-binding and ribonuclease activities in vitro.	No verified direct reference in this release
`At5g12440`	Zinc finger CCCH domain-containing protein 55.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0682400`	Zinc finger CCCH domain-containing protein 53.	No verified direct reference in this release
`Os03g0329200`	Zinc finger CCCH domain-containing protein 23.	No verified direct reference in this release
`Os03g0328900`	Zinc finger CCCH domain-containing protein 22.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034189 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0004518 nuclease activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0016787 hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT3G51950

ath:AT5G12440

dosa:Os03g0328900

dosa:Os03g0329200

dosa:Os07g0682400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.597

Rank 1 · LXL04_034189 · OH-1004

Cytoplasm0.411

Rank 2 · LXL04_034189 · OH-1004

Cell membrane0.095

Rank 3 · LXL04_034189 · OH-1004

Endoplasmic reticulum0.040

Rank 4 · LXL04_034189 · OH-1004

Lysosome / Vacuole0.025

Rank 5 · LXL04_034189 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23182.2PABC_AtC3H461-65 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_034189	`PF23182.2`	PABC_AtC3H46	1	65	3.6e-33	114.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SV09`	Arabidopsis thaliana	Zinc finger CCCH domain-containing protein 46	44.150%	Swiss-Prot	moderate database homology
`Q94CJ8`	Arabidopsis thaliana	Zinc finger CCCH domain-containing protein 55	38.494%	Swiss-Prot	moderate database homology
`Q0D3J9`	Oryza sativa subsp. japonica	Zinc finger CCCH domain-containing protein 53	48.163%	Swiss-Prot	moderate database homology
`Q10LZ9`	Oryza sativa subsp. japonica	Zinc finger CCCH domain-containing protein 23	47.059%	Swiss-Prot	moderate database homology
`Q10M00`	Oryza sativa subsp. japonica	Zinc finger CCCH domain-containing protein 22	46.040%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card