LXL04_030641 | RubberDandelionOmics

Gene overview

LXL04_030641

Reference: OH-1004 Chr: Chr06 Coordinates: 120143799-120144383 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

585 bp · LXL04_030641|LXL04_030641|OH1004|cDNA

ATGTTCGACACGAATGAAAAGGAATCGCTACTGGAAGAAATCAAAACTTTAAGAACCAAACTCCAATCATCGCCTTCCATAAACAAATCAATCGACAGGGTGAGATCGTCCTCGCTTTTATCCCAATCGCTCCAATTAAGAAAAAGCGGCGCGTACCCTAAATCGGAAACCAGCGAAGAACTCGAGAATGAGAGAGAAAGGTGGATGGAGATGGAGAGCGAATGGATCTATTTAACCGACGAACTGAGAGTCGACCTAGA...

CDS

Download CDS FASTA

585 bp · LXL04_030641|LXL04_030641|OH1004|CDS

ATGTTCGACACGAATGAAAAGGAATCGCTACTGGAAGAAATCAAAACTTTAAGAACCAAACTCCAATCATCGCCTTCCATAAACAAATCAATCGACAGGGTGAGATCGTCCTCGCTTTTATCCCAATCGCTCCAATTAAGAAAAAGCGGCGCGTACCCTAAATCGGAAACCAGCGAAGAACTCGAGAATGAGAGAGAAAGGTGGATGGAGATGGAGAGCGAATGGATCTATTTAACCGACGAACTGAGAGTCGACCTAGA...

Protein

Download Protein FASTA

194 aa · LXL04_030641|LXL04_030641|OH1004|PROTEIN

MFDTNEKESLLEEIKTLRTKLQSSPSINKSIDRVRSSSLLSQSLQLRKSGAYPKSETSEELENERERWMEMESEWIYLTDELRVDLEANRRRSENVEMELRLEKKCSEELDDALMRSILGHGKMVEHYADLQEIPTVAPVEVRRSRSDGRDGQRTTGYRDGEEGGRDVEGFLEVVGTLFITHRNSFYLQNCHRI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030641`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030641

Location Chr06:120143799-120144383 (+)

Description Similar to KIN12F: Kinesin-like protein KIN-12F

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20150`	Kinesin-like protein KIN-12F.	No verified direct reference in this release
`At4g14150`	Plus-end directed kinesin-like motor enzyme that plays a critical role in the organization of phragmoplast microtubules during cytokinesis.	Identification of a phragmoplast-associated kinesin-related protein in higher plants.2000 · DOI: 10.1016/s0960-9822(00)00564-9 Two Arabidopsis phragmoplast-associated kinesins play a critical role in cytokinesis during male gametogenesis.2007 · DOI: 10.1105/tpc.107.050716
`At3g23670`	Plus-end directed kinesin-like motor enzyme that plays a critical role in the organization of phragmoplast microtubules during cytokinesis.	Two Arabidopsis phragmoplast-associated kinesins play a critical role in cytokinesis during male gametogenesis.2007 · DOI: 10.1105/tpc.107.050716

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0587200`	Kinesin-like protein KIN-12C.	No verified direct reference in this release
`Os04g0350300`	Plus-end directed kinesin-like motor enzyme that plays a critical role in the organization of phragmoplast microtubules during cytokinesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030641 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007018 microtubule-based movement Biological Process

GO:0007112 male meiosis cytokinesis Biological Process

GO:0055046 microgametogenesis Biological Process

GO:0080175 phragmoplast microtubule organization Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005871 kinesin complex Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0003777 microtubule motor activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008017 microtubule binding Molecular Function

KEGG gene cross-reference

ath:AT3G20150

ath:AT3G23670

ath:AT4G14150

dosa:Os03g0587200

dosa:Os04g0350300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.498

Rank 1 · LXL04_030641 · OH-1004

Nucleus0.377

Rank 2 · LXL04_030641 · OH-1004

Cell membrane0.099

Rank 3 · LXL04_030641 · OH-1004

Mitochondrion0.066

Rank 4 · LXL04_030641 · OH-1004

Golgi apparatus0.052

Rank 5 · LXL04_030641 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JDI6`	Arabidopsis thaliana	Kinesin-like protein KIN-12F	50.758%	Swiss-Prot	moderate database homology
`Q9LDN0`	Arabidopsis thaliana	Kinesin-like protein KIN-12A	39.706%	Swiss-Prot	moderate database homology
`Q8L7Y8`	Arabidopsis thaliana	Kinesin-like protein KIN-12B	37.059%	Swiss-Prot	moderate database homology
`Q5W6L9`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-12C	46.667%	Swiss-Prot	moderate database homology
`Q7XKR9`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-12A	38.931%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card