LXL04_030270 | RubberDandelionOmics

Gene overview

LXL04_030270

Reference: OH-1004 Chr: Chr06 Coordinates: 113036095-113038538 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2046 bp · LXL04_030270|LXL04_030270|OH1004|cDNA

ATGGCTCCGACGTCGTTCTATTGGTGGGGGAAAGAGACCCATCGGGGTACTCCGGTGGTGGTGAAGATGGAGAACCCAAACAACTGGTCAATGGTGGAGATTGAAAGCCCCACCGAGGACGATTTCCTGCACAAAGGTCGTGGTCGTAACAAGAACGCTAAGCAGCTTACATGGGTTTTACTCCTCAAAGCCCATCGCGCCGCCGGCTGTCTCACCTCCATTGCATCCGCCACACTCTCCATCGCAACCGCCGTCCGCCG...

CDS

Download CDS FASTA

2046 bp · LXL04_030270|LXL04_030270|OH1004|CDS

ATGGCTCCGACGTCGTTCTATTGGTGGGGGAAAGAGACCCATCGGGGTACTCCGGTGGTGGTGAAGATGGAGAACCCAAACAACTGGTCAATGGTGGAGATTGAAAGCCCCACCGAGGACGATTTCCTGCACAAAGGTCGTGGTCGTAACAAGAACGCTAAGCAGCTTACATGGGTTTTACTCCTCAAAGCCCATCGCGCCGCCGGCTGTCTCACCTCCATTGCATCCGCCACACTCTCCATCGCAACCGCCGTCCGCCG...

Protein

Download Protein FASTA

681 aa · LXL04_030270|LXL04_030270|OH1004|PROTEIN

MAPTSFYWWGKETHRGTPVVVKMENPNNWSMVEIESPTEDDFLHKGRGRNKNAKQLTWVLLLKAHRAAGCLTSIASATLSIATAVRRRLSSGRTDTDIDNERPMRTSTRFYSCIKVFLWVSVVLLGFEVAAYYKGWHFEAPDLHLQYLYTLTNPFAFTGLFNSIYSKWVSIRVEYLAPPLQFLANTCIYLFLIQSLDRLVLCLGCFWIRFKKIKPVAKQILPDVESGDDDGSFPMVLVQIPMCNEKEVYQQSIGAVCNLE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030270`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030270

Location Chr06:113036095-113038538 (+)

Description Similar to CSLC12: Probable xyloglucan glycosyltransferase 12

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g07960`	Probable beta-1,4-glucan synthase rather involved in the synthesis of the xyloglucan backbone than cellulose.	No verified direct reference in this release
`At4g31590`	Probable beta-1,4-glucan synthase rather involved in the synthesis of the xyloglucan backbone than cellulose.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0510800`	Probable beta-1,4-glucan synthase rather involved in the synthesis of the xyloglucan backbone than cellulose.	No verified direct reference in this release
`Os01g0766900`	Probable beta-1,4-glucan synthase rather involved in the synthesis of the xyloglucan backbone than cellulose.	No verified direct reference in this release
`Os07g0124750`	Probable beta-1,4-glucan synthase rather involved in the synthesis of the xyloglucan backbone than cellulose.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030270 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0048868 pollen tube development Biological Process

GO:0071555 cell wall organization Biological Process

GO:0099402 plant organ development Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016757 glycosyltransferase activity Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

KEGG gene cross-reference

ath:AT4G07960

ath:AT4G31590

dosa:Os05g0510800

osa:107275797

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.292

Rank 1 · LXL04_030270 · OH-1004

Golgi apparatus0.290

Rank 2 · LXL04_030270 · OH-1004

Cell membrane0.265

Rank 3 · LXL04_030270 · OH-1004

Cytoplasm0.123

Rank 4 · LXL04_030270 · OH-1004

Lysosome / Vacuole0.090

Rank 5 · LXL04_030270 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13506.14Glyco_transf_21232-515 aa

PF13641.13Glyco_tranf_2_3234-467 aa

PF00535.33Glycos_transf_2239-394 aa

PF13632.13Glyco_trans_2_3328-536 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030270	`PF13506.14`	Glyco_transf_21	232	515	1.6e-15	57.5
LXL04_030270	`PF13641.13`	Glyco_tranf_2_3	234	467	2.3e-17	64.2
LXL04_030270	`PF00535.33`	Glycos_transf_2	239	394	6.5e-13	49.7
LXL04_030270	`PF13632.13`	Glyco_trans_2_3	328	536	1.2e-21	78.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZQB9`	Arabidopsis thaliana	Probable xyloglucan glycosyltransferase 12	76.379%	Swiss-Prot	strong database homology
`Q9SB75`	Arabidopsis thaliana	Probable xyloglucan glycosyltransferase 5	66.667%	Swiss-Prot	strong database homology
`Q6L538`	Oryza sativa subsp. japonica	Probable xyloglucan glycosyltransferase 7	73.117%	Swiss-Prot	strong database homology
`Q8LIY0`	Oryza sativa subsp. japonica	Probable xyloglucan glycosyltransferase 1	71.449%	Swiss-Prot	strong database homology
`Q84Z01`	Oryza sativa subsp. japonica	Putative xyloglucan glycosyltransferase 10	68.732%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card