LXL04_029168 | RubberDandelionOmics

Gene overview

LXL04_029168

Reference: OH-1004 Chr: Chr06 Coordinates: 82161924-82165268 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1533 bp · LXL04_029168|LXL04_029168|OH1004|cDNA

ATGGGTGCTTTAACGGGTAATCGCAACAAGCGTGACGCAGAATTTCGATATTCATCACCATCCGGGGTCGATTATAATCCTCTTCACGTTGCGAAGAAACTCAAATCATCATCCTCGTCTTCGCCTCTCATTGCTCCAACGGAAACCTCAAGAAGGCTTAGACAATATCCTCCGCCAACCCCCATCGTCAGAGAAGTTCATGCTCCGTGTAGAATTTTTAGTGGATTTACTGGTAGCTCGAAAAGACTTATTGGCGGCTA...

CDS

Download CDS FASTA

1533 bp · LXL04_029168|LXL04_029168|OH1004|CDS

ATGGGTGCTTTAACGGGTAATCGCAACAAGCGTGACGCAGAATTTCGATATTCATCACCATCCGGGGTCGATTATAATCCTCTTCACGTTGCGAAGAAACTCAAATCATCATCCTCGTCTTCGCCTCTCATTGCTCCAACGGAAACCTCAAGAAGGCTTAGACAATATCCTCCGCCAACCCCCATCGTCAGAGAAGTTCATGCTCCGTGTAGAATTTTTAGTGGATTTACTGGTAGCTCGAAAAGACTTATTGGCGGCTA...

Protein

Download Protein FASTA

510 aa · LXL04_029168|LXL04_029168|OH1004|PROTEIN

MGALTGNRNKRDAEFRYSSPSGVDYNPLHVAKKLKSSSSSSPLIAPTETSRRLRQYPPPTPIVREVHAPCRIFSGFTGSSKRLIGGYSGIVEQKSDFAGDNGRNDLDWKYNQAKKSAIGTCKFVVFEEEGEGEEEGEVEVIDVDNDETVKAVSRSSSVEEVEMVKDGIAHIHRSGEAQEIAAKYWELDQKTPSTSSEVVSELTNGKMLESLSMNRWSDAMDVDFGFPLHKKLLNQSAERDPKLRRIQFEIQLEEARRSRH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029168`
TK1151 ID	TkA07G281390
OH-1004 ID	LXL04_029168
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029168

Location Chr06:82161924-82165268 (+)

Description Similar to ESD4: Ubiquitin-like-specific protease ESD4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g15880`	Protease that catalyzes two essential functions in the SUMO pathway: processing of full-length SUMOs to their mature forms and deconjugation of SUMO from targeted proteins.	A nuclear protease required for flowering-time regulation in Arabidopsis reduces the abundance of SMALL UBIQUITIN-RELATED MODIFIER conjugates.2003 · DOI: 10.1105/tpc.015487
`At4g00690`	Protease that catalyzes two essential functions in the SUMO pathway: processing of full-length SUMOs to their mature forms and deconjugation of SUMO from targeted proteins.	No verified direct reference in this release
`At3g06910`	Protease that catalyzes two essential functions in the SUMO pathway: processing of full-length SUMOs to their mature forms and deconjugation of SUMO from targeted proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029168 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0009911 positive regulation of flower development Biological Process

GO:0015031 protein transport Biological Process

GO:0016055 Wnt signaling pathway Biological Process

GO:0016485 protein processing Biological Process

GO:0016925 protein sumoylation Biological Process

GO:0016926 protein desumoylation Biological Process

GO:0030111 regulation of Wnt signaling pathway Biological Process

GO:0031397 negative regulation of protein ubiquitination Biological Process

GO:0031398 positive regulation of protein ubiquitination Biological Process

GO:0031648 protein destabilization Biological Process

KEGG gene cross-reference

ath:AT3G06910

ath:AT4G00690

ath:AT4G15880

hsa:59343

spo:2540734

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.887

Rank 1 · LXL04_029168 · OH-1004

Cytoplasm0.184

Rank 2 · LXL04_029168 · OH-1004

Cell membrane0.035

Rank 3 · LXL04_029168 · OH-1004

Mitochondrion0.027

Rank 4 · LXL04_029168 · OH-1004

Endoplasmic reticulum0.019

Rank 5 · LXL04_029168 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02902.26Peptidase_C48323-504 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029168	`PF02902.26`	Peptidase_C48	323	504	4.4e-43	148.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94F30`	Arabidopsis thaliana	Ubiquitin-like-specific protease ESD4	44.669%	Swiss-Prot	moderate database homology
`O65278`	Arabidopsis thaliana	Putative ubiquitin-like-specific protease 1B	65.126%	Swiss-Prot	weak database homology
`Q8GYL3`	Arabidopsis thaliana	Ubiquitin-like-specific protease 1A	42.308%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card